Incidental Mutation 'BB010:Usp24'
ID 642571
Institutional Source Beutler Lab
Gene Symbol Usp24
Ensembl Gene ENSMUSG00000028514
Gene Name ubiquitin specific peptidase 24
Synonyms 2700066K03Rik, 2810030C21Rik
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # BB010
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 106173410-106298519 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 106285686 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 2437 (N2437S)
Ref Sequence ENSEMBL: ENSMUSP00000133095 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094933] [ENSMUST00000165709]
AlphaFold B1AY13
Predicted Effect probably benign
Transcript: ENSMUST00000094933
AA Change: N2436S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000092538
Gene: ENSMUSG00000028514
AA Change: N2436S

DomainStartEndE-ValueType
Blast:UBA 5 43 2e-16 BLAST
low complexity region 57 96 N/A INTRINSIC
SCOP:d1gw5a_ 348 882 6e-7 SMART
low complexity region 1031 1059 N/A INTRINSIC
low complexity region 1124 1150 N/A INTRINSIC
low complexity region 1365 1378 N/A INTRINSIC
Pfam:UCH 1685 2036 3.7e-54 PFAM
Pfam:UCH_1 1686 1993 1.8e-27 PFAM
low complexity region 2066 2081 N/A INTRINSIC
low complexity region 2256 2267 N/A INTRINSIC
low complexity region 2576 2592 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165709
AA Change: N2437S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000133095
Gene: ENSMUSG00000028514
AA Change: N2437S

DomainStartEndE-ValueType
Blast:UBA 5 43 2e-16 BLAST
low complexity region 57 96 N/A INTRINSIC
SCOP:d1gw5a_ 348 883 8e-7 SMART
low complexity region 1032 1060 N/A INTRINSIC
low complexity region 1125 1151 N/A INTRINSIC
low complexity region 1366 1379 N/A INTRINSIC
Pfam:UCH 1686 2037 2e-49 PFAM
Pfam:UCH_1 1687 1994 4e-24 PFAM
low complexity region 2067 2082 N/A INTRINSIC
low complexity region 2257 2268 N/A INTRINSIC
low complexity region 2577 2593 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Modification of cellular proteins by ubiquitin is an essential regulatory mechanism controlled by the coordinated action of multiple ubiquitin-conjugating and deubiquitinating enzymes. USP24 belongs to a large family of cysteine proteases that function as deubiquitinating enzymes (Quesada et al., 2004 [PubMed 14715245]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933414I15Rik A G 11: 50,833,227 (GRCm39) V125A unknown Het
Adam34 T A 8: 44,103,911 (GRCm39) H578L probably damaging Het
Ago4 A T 4: 126,400,811 (GRCm39) M678K probably benign Het
Atosb A T 4: 43,035,919 (GRCm39) C271S probably benign Het
Atrn T C 2: 130,836,986 (GRCm39) L1150P probably damaging Het
Camta1 C T 4: 151,168,214 (GRCm39) E279K probably damaging Het
Ccdc88c T C 12: 100,911,749 (GRCm39) D695G possibly damaging Het
Col11a2 A T 17: 34,275,029 (GRCm39) K400* probably null Het
Cpsf4 T A 5: 145,104,168 (GRCm39) M1K probably null Het
Dnah12 A T 14: 26,488,072 (GRCm39) Q992L probably benign Het
Dnajc7 T C 11: 100,487,038 (GRCm39) Y145C probably damaging Het
Eml5 A T 12: 98,810,279 (GRCm39) D892E possibly damaging Het
Fam193a A G 5: 34,623,539 (GRCm39) K23E possibly damaging Het
Filip1 T G 9: 79,727,329 (GRCm39) K430T possibly damaging Het
Gm5089 T C 14: 122,673,403 (GRCm39) D106G unknown Het
Hip1 A T 5: 135,489,310 (GRCm39) N45K probably damaging Het
Hivep2 T C 10: 14,003,581 (GRCm39) S60P probably damaging Het
Ighv1-53 A T 12: 115,122,029 (GRCm39) C115* probably null Het
Macf1 T C 4: 123,303,444 (GRCm39) T353A probably benign Het
Mast3 A T 8: 71,239,279 (GRCm39) V433E probably damaging Het
Mast4 A T 13: 102,909,071 (GRCm39) M660K probably damaging Het
Nr2e1 T C 10: 42,439,379 (GRCm39) Y380C probably damaging Het
Or10g9b T C 9: 39,918,431 (GRCm39) probably benign Het
Or5b111 T A 19: 13,291,569 (GRCm39) M27L probably benign Het
Otog A G 7: 45,959,571 (GRCm39) D720G probably damaging Het
Slc6a1 T A 6: 114,288,859 (GRCm39) W473R probably damaging Het
Smpd3 A C 8: 106,982,254 (GRCm39) C617G probably benign Het
Spata31d1e A G 13: 59,891,565 (GRCm39) L85P probably damaging Het
Sprr3 T C 3: 92,364,515 (GRCm39) I110V possibly damaging Het
Ston1 A G 17: 88,943,572 (GRCm39) E326G probably benign Het
Tapbpl T G 6: 125,207,233 (GRCm39) Q152P probably damaging Het
Tectb C T 19: 55,183,105 (GRCm39) L319F possibly damaging Het
Tpp2 G A 1: 44,000,121 (GRCm39) G413D probably damaging Het
Tpsg1 A G 17: 25,592,178 (GRCm39) H84R probably damaging Het
Usp32 T C 11: 84,897,885 (GRCm39) Q1152R probably damaging Het
Vmn2r6 T C 3: 64,467,224 (GRCm39) T92A probably benign Het
Xpo7 A G 14: 70,944,788 (GRCm39) V35A probably benign Het
Zan T A 5: 137,461,841 (GRCm39) T1113S unknown Het
Zfp169 A G 13: 48,643,957 (GRCm39) V390A unknown Het
Other mutations in Usp24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00329:Usp24 APN 4 106,216,288 (GRCm39) missense probably benign
IGL00340:Usp24 APN 4 106,258,336 (GRCm39) missense probably damaging 0.99
IGL00480:Usp24 APN 4 106,225,303 (GRCm39) missense probably damaging 0.99
IGL00548:Usp24 APN 4 106,198,495 (GRCm39) missense probably damaging 0.96
IGL00655:Usp24 APN 4 106,247,515 (GRCm39) missense probably damaging 0.99
IGL00674:Usp24 APN 4 106,229,876 (GRCm39) splice site probably benign
IGL00718:Usp24 APN 4 106,266,901 (GRCm39) missense probably benign 0.10
IGL00803:Usp24 APN 4 106,242,723 (GRCm39) splice site probably benign
IGL01161:Usp24 APN 4 106,294,041 (GRCm39) missense probably benign 0.02
IGL01344:Usp24 APN 4 106,236,582 (GRCm39) missense possibly damaging 0.73
IGL01374:Usp24 APN 4 106,237,296 (GRCm39) missense possibly damaging 0.86
IGL01485:Usp24 APN 4 106,219,429 (GRCm39) missense probably benign 0.01
IGL01736:Usp24 APN 4 106,280,658 (GRCm39) missense probably benign 0.00
IGL01737:Usp24 APN 4 106,244,931 (GRCm39) missense probably benign 0.03
IGL01862:Usp24 APN 4 106,266,095 (GRCm39) splice site probably benign
IGL01981:Usp24 APN 4 106,232,965 (GRCm39) splice site probably benign
IGL02090:Usp24 APN 4 106,268,623 (GRCm39) missense possibly damaging 0.55
IGL02275:Usp24 APN 4 106,244,690 (GRCm39) missense probably damaging 1.00
IGL02352:Usp24 APN 4 106,261,122 (GRCm39) missense probably damaging 1.00
IGL02359:Usp24 APN 4 106,261,122 (GRCm39) missense probably damaging 1.00
IGL02391:Usp24 APN 4 106,264,326 (GRCm39) missense possibly damaging 0.60
IGL02418:Usp24 APN 4 106,293,557 (GRCm39) missense probably benign 0.07
IGL02537:Usp24 APN 4 106,249,564 (GRCm39) missense probably damaging 1.00
IGL02638:Usp24 APN 4 106,295,969 (GRCm39) splice site probably benign
IGL02638:Usp24 APN 4 106,295,967 (GRCm39) splice site probably benign
IGL02830:Usp24 APN 4 106,204,584 (GRCm39) missense possibly damaging 0.79
IGL03125:Usp24 APN 4 106,249,599 (GRCm39) missense probably benign 0.09
IGL03280:Usp24 APN 4 106,237,627 (GRCm39) missense probably damaging 1.00
IGL03350:Usp24 APN 4 106,228,276 (GRCm39) nonsense probably null
BB020:Usp24 UTSW 4 106,285,686 (GRCm39) missense probably benign
IGL03098:Usp24 UTSW 4 106,228,230 (GRCm39) missense probably benign 0.11
R0035:Usp24 UTSW 4 106,225,224 (GRCm39) missense probably benign 0.18
R0044:Usp24 UTSW 4 106,269,281 (GRCm39) splice site probably benign
R0086:Usp24 UTSW 4 106,249,557 (GRCm39) missense probably damaging 0.98
R0125:Usp24 UTSW 4 106,254,496 (GRCm39) missense possibly damaging 0.76
R0197:Usp24 UTSW 4 106,264,330 (GRCm39) missense probably damaging 1.00
R0240:Usp24 UTSW 4 106,271,601 (GRCm39) nonsense probably null
R0240:Usp24 UTSW 4 106,271,601 (GRCm39) nonsense probably null
R0491:Usp24 UTSW 4 106,259,302 (GRCm39) missense probably benign 0.41
R0687:Usp24 UTSW 4 106,277,701 (GRCm39) missense probably damaging 1.00
R0973:Usp24 UTSW 4 106,270,875 (GRCm39) splice site probably null
R0973:Usp24 UTSW 4 106,228,276 (GRCm39) nonsense probably null
R0973:Usp24 UTSW 4 106,228,276 (GRCm39) nonsense probably null
R0974:Usp24 UTSW 4 106,270,875 (GRCm39) splice site probably null
R0974:Usp24 UTSW 4 106,228,276 (GRCm39) nonsense probably null
R1163:Usp24 UTSW 4 106,278,157 (GRCm39) missense probably benign
R1293:Usp24 UTSW 4 106,280,750 (GRCm39) missense probably benign 0.19
R1333:Usp24 UTSW 4 106,199,550 (GRCm39) missense possibly damaging 0.55
R1476:Usp24 UTSW 4 106,219,130 (GRCm39) missense probably damaging 1.00
R1699:Usp24 UTSW 4 106,296,024 (GRCm39) missense probably damaging 0.99
R1728:Usp24 UTSW 4 106,217,618 (GRCm39) missense possibly damaging 0.85
R1729:Usp24 UTSW 4 106,217,618 (GRCm39) missense possibly damaging 0.85
R1753:Usp24 UTSW 4 106,234,756 (GRCm39) missense probably benign 0.04
R1917:Usp24 UTSW 4 106,267,483 (GRCm39) missense probably damaging 1.00
R2045:Usp24 UTSW 4 106,258,177 (GRCm39) missense possibly damaging 0.54
R2424:Usp24 UTSW 4 106,256,310 (GRCm39) critical splice donor site probably null
R2436:Usp24 UTSW 4 106,266,842 (GRCm39) nonsense probably null
R2513:Usp24 UTSW 4 106,236,602 (GRCm39) splice site probably null
R3824:Usp24 UTSW 4 106,236,263 (GRCm39) missense probably benign
R3831:Usp24 UTSW 4 106,219,209 (GRCm39) critical splice donor site probably null
R3833:Usp24 UTSW 4 106,219,209 (GRCm39) critical splice donor site probably null
R3982:Usp24 UTSW 4 106,245,080 (GRCm39) missense probably benign 0.38
R4022:Usp24 UTSW 4 106,236,421 (GRCm39) splice site probably benign
R4067:Usp24 UTSW 4 106,216,286 (GRCm39) missense possibly damaging 0.68
R4175:Usp24 UTSW 4 106,173,970 (GRCm39) missense probably benign 0.00
R4766:Usp24 UTSW 4 106,273,245 (GRCm39) missense probably damaging 1.00
R4771:Usp24 UTSW 4 106,219,377 (GRCm39) splice site probably null
R4798:Usp24 UTSW 4 106,217,359 (GRCm39) missense possibly damaging 0.82
R4809:Usp24 UTSW 4 106,270,873 (GRCm39) critical splice donor site probably null
R4822:Usp24 UTSW 4 106,273,244 (GRCm39) missense probably damaging 0.98
R4906:Usp24 UTSW 4 106,245,834 (GRCm39) missense probably benign 0.20
R4934:Usp24 UTSW 4 106,283,743 (GRCm39) missense probably benign 0.29
R5074:Usp24 UTSW 4 106,277,644 (GRCm39) missense probably benign 0.12
R5151:Usp24 UTSW 4 106,256,309 (GRCm39) critical splice donor site probably null
R5220:Usp24 UTSW 4 106,239,500 (GRCm39) missense possibly damaging 0.69
R5279:Usp24 UTSW 4 106,242,621 (GRCm39) missense possibly damaging 0.94
R5280:Usp24 UTSW 4 106,198,411 (GRCm39) missense probably benign 0.18
R5285:Usp24 UTSW 4 106,264,230 (GRCm39) missense probably benign 0.00
R5292:Usp24 UTSW 4 106,275,460 (GRCm39) missense probably benign 0.06
R5294:Usp24 UTSW 4 106,219,554 (GRCm39) missense possibly damaging 0.53
R5394:Usp24 UTSW 4 106,265,210 (GRCm39) missense probably damaging 1.00
R5517:Usp24 UTSW 4 106,232,871 (GRCm39) missense probably benign 0.02
R5522:Usp24 UTSW 4 106,229,918 (GRCm39) missense probably damaging 1.00
R5546:Usp24 UTSW 4 106,273,244 (GRCm39) missense probably damaging 0.98
R5756:Usp24 UTSW 4 106,219,680 (GRCm39) missense probably damaging 1.00
R5910:Usp24 UTSW 4 106,237,665 (GRCm39) missense probably damaging 0.99
R5972:Usp24 UTSW 4 106,225,264 (GRCm39) missense probably damaging 0.98
R6285:Usp24 UTSW 4 106,231,297 (GRCm39) splice site probably null
R6370:Usp24 UTSW 4 106,237,718 (GRCm39) missense probably null 0.20
R6630:Usp24 UTSW 4 106,245,032 (GRCm39) missense possibly damaging 0.69
R6754:Usp24 UTSW 4 106,217,617 (GRCm39) missense probably damaging 1.00
R7027:Usp24 UTSW 4 106,219,441 (GRCm39) missense probably benign 0.21
R7088:Usp24 UTSW 4 106,244,743 (GRCm39) missense probably damaging 1.00
R7129:Usp24 UTSW 4 106,219,412 (GRCm39) missense probably damaging 1.00
R7131:Usp24 UTSW 4 106,239,500 (GRCm39) missense possibly damaging 0.69
R7156:Usp24 UTSW 4 106,245,116 (GRCm39) critical splice donor site probably null
R7174:Usp24 UTSW 4 106,219,878 (GRCm39) splice site probably null
R7236:Usp24 UTSW 4 106,263,502 (GRCm39) splice site probably null
R7403:Usp24 UTSW 4 106,264,232 (GRCm39) missense possibly damaging 0.79
R7424:Usp24 UTSW 4 106,236,304 (GRCm39) missense probably benign 0.00
R7475:Usp24 UTSW 4 106,199,550 (GRCm39) missense possibly damaging 0.55
R7505:Usp24 UTSW 4 106,236,276 (GRCm39) missense probably damaging 1.00
R7782:Usp24 UTSW 4 106,173,771 (GRCm39) missense probably damaging 1.00
R7900:Usp24 UTSW 4 106,266,597 (GRCm39) missense probably damaging 1.00
R7933:Usp24 UTSW 4 106,285,686 (GRCm39) missense probably benign
R7940:Usp24 UTSW 4 106,287,741 (GRCm39) missense probably damaging 0.98
R8271:Usp24 UTSW 4 106,285,711 (GRCm39) missense probably damaging 0.98
R8348:Usp24 UTSW 4 106,225,933 (GRCm39) missense possibly damaging 0.82
R8448:Usp24 UTSW 4 106,225,933 (GRCm39) missense possibly damaging 0.82
R8483:Usp24 UTSW 4 106,230,953 (GRCm39) missense probably damaging 1.00
R8546:Usp24 UTSW 4 106,259,326 (GRCm39) missense probably benign 0.01
R8798:Usp24 UTSW 4 106,236,436 (GRCm39) missense probably benign 0.00
R8822:Usp24 UTSW 4 106,269,410 (GRCm39) missense probably benign 0.17
R8992:Usp24 UTSW 4 106,234,762 (GRCm39) missense probably benign 0.36
R9002:Usp24 UTSW 4 106,275,412 (GRCm39) missense possibly damaging 0.72
R9037:Usp24 UTSW 4 106,236,251 (GRCm39) missense probably damaging 0.99
R9068:Usp24 UTSW 4 106,232,875 (GRCm39) missense probably benign 0.09
R9096:Usp24 UTSW 4 106,254,508 (GRCm39) missense probably benign 0.00
R9180:Usp24 UTSW 4 106,216,247 (GRCm39) missense possibly damaging 0.71
R9199:Usp24 UTSW 4 106,244,681 (GRCm39) missense probably damaging 1.00
R9201:Usp24 UTSW 4 106,277,727 (GRCm39) missense probably benign 0.36
R9251:Usp24 UTSW 4 106,217,715 (GRCm39) missense probably benign 0.19
R9423:Usp24 UTSW 4 106,288,867 (GRCm39) missense probably damaging 1.00
R9459:Usp24 UTSW 4 106,199,555 (GRCm39) missense probably damaging 1.00
R9472:Usp24 UTSW 4 106,261,128 (GRCm39) missense probably benign 0.00
R9483:Usp24 UTSW 4 106,219,379 (GRCm39) missense probably damaging 0.99
R9534:Usp24 UTSW 4 106,264,312 (GRCm39) missense probably damaging 0.97
R9653:Usp24 UTSW 4 106,204,564 (GRCm39) missense probably benign 0.03
R9712:Usp24 UTSW 4 106,204,564 (GRCm39) missense probably benign 0.03
X0024:Usp24 UTSW 4 106,217,643 (GRCm39) missense probably benign 0.09
X0028:Usp24 UTSW 4 106,225,252 (GRCm39) missense probably benign 0.01
X0066:Usp24 UTSW 4 106,212,928 (GRCm39) missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- ATAATACTGGGCTGAGACTGC -3'
(R):5'- ACCCAGTAAGGAACTAGCGG -3'

Sequencing Primer
(F):5'- TGGGCTGAGACTGCCTTCAC -3'
(R):5'- TCTACAGAGTGAGTTCCAGGAC -3'
Posted On 2020-08-01