Mutagenetix > Incidental Mutation

Incidental Mutation 'BB010:Ago4'

642573

Institutional Source

Beutler Lab

Gene Symbol

Ago4

Ensembl Gene

ENSMUSG00000042500

Gene Name

argonaute RISC catalytic subunit 4

Synonyms

argonaute 4, Eif2c4, 5730550L01Rik

Accession Numbers

Essential gene?

Probably essential (E-score: 0.872) question?

Stock #

BB010

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

126489541-126533472 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 126507018 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 678 (M678K)

Ref Sequence

ENSEMBL: ENSMUSP00000081312 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084289]

AlphaFold

Q8CJF8

Predicted Effect

probably benign
Transcript: ENSMUST00000084289
AA Change: M678K

PolyPhen 2 Score 0.220 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000081312
Gene: ENSMUSG00000042500
AA Change: M678K

Domain	Start	End	E-Value	Type
Pfam:ArgoN	18	156	3.9e-28	PFAM
DUF1785	165	217	4.22e-24	SMART
PAZ	225	360	1.26e-3	SMART
Pfam:ArgoL2	365	412	1.2e-16	PFAM
Pfam:ArgoMid	421	503	8.6e-35	PFAM
Piwi	509	820	2.9e-130	SMART
Blast:Piwi	827	856	2e-9	BLAST

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Argonaute family of proteins which contain PAZ and PIWI domains and play an integral role in RNA interference and short-interfering-RNA-mediated gene silencing. This gene is located on chromosome 1 in a cluster of related family members. [provided by RefSeq, Mar 2017]
PHENOTYPE: Male mice homozygous for a null mutation display oligozoospermia, decreased testis weight, premature entry into meiosis and disruption of sex body formation. However both males and females are fertile. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	A	G	13: 59,743,751	L85P	probably damaging	Het
4933414I15Rik	A	G	11: 50,942,400	V125A	unknown	Het
Adam34	T	A	8: 43,650,874	H578L	probably damaging	Het
Atrn	T	C	2: 130,995,066	L1150P	probably damaging	Het
Camta1	C	T	4: 151,083,757	E279K	probably damaging	Het
Ccdc88c	T	C	12: 100,945,490	D695G	possibly damaging	Het
Col11a2	A	T	17: 34,056,055	K400*	probably null	Het
Cpsf4	T	A	5: 145,167,358	M1K	probably null	Het
Dnah12	A	T	14: 26,766,115	Q992L	probably benign	Het
Dnajc7	T	C	11: 100,596,212	Y145C	probably damaging	Het
Eml5	A	T	12: 98,844,020	D892E	possibly damaging	Het
Fam193a	A	G	5: 34,466,195	K23E	possibly damaging	Het
Fam214b	A	T	4: 43,035,919	C271S	probably benign	Het
Filip1	T	G	9: 79,820,047	K430T	possibly damaging	Het
Gm5089	T	C	14: 122,435,991	D106G	unknown	Het
Hip1	A	T	5: 135,460,456	N45K	probably damaging	Het
Hivep2	T	C	10: 14,127,837	S60P	probably damaging	Het
Ighv1-53	A	T	12: 115,158,409	C115*	probably null	Het
Macf1	T	C	4: 123,409,651	T353A	probably benign	Het
Mast3	A	T	8: 70,786,635	V433E	probably damaging	Het
Mast4	A	T	13: 102,772,563	M660K	probably damaging	Het
Nr2e1	T	C	10: 42,563,383	Y380C	probably damaging	Het
Olfr1465	T	A	19: 13,314,205	M27L	probably benign	Het
Olfr980	T	C	9: 40,007,135		probably benign	Het
Otog	A	G	7: 46,310,147	D720G	probably damaging	Het
Slc6a1	T	A	6: 114,311,898	W473R	probably damaging	Het
Smpd3	A	C	8: 106,255,622	C617G	probably benign	Het
Sprr3	T	C	3: 92,457,208	I110V	possibly damaging	Het
Ston1	A	G	17: 88,636,144	E326G	probably benign	Het
Tapbpl	T	G	6: 125,230,270	Q152P	probably damaging	Het
Tectb	C	T	19: 55,194,673	L319F	possibly damaging	Het
Tpp2	G	A	1: 43,960,961	G413D	probably damaging	Het
Tpsg1	A	G	17: 25,373,204	H84R	probably damaging	Het
Usp24	A	G	4: 106,428,489	N2437S	probably benign	Het
Usp32	T	C	11: 85,007,059	Q1152R	probably damaging	Het
Vmn2r6	T	C	3: 64,559,803	T92A	probably benign	Het
Xpo7	A	G	14: 70,707,348	V35A	probably benign	Het
Zan	T	A	5: 137,463,579	T1113S	unknown	Het
Zfp169	A	G	13: 48,490,481	V390A	unknown	Het

Other mutations in Ago4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00957:Ago4	APN	4	126517133	missense	probably benign	0.01
IGL00965:Ago4	APN	4	126493314	missense	probably benign	0.01
IGL01306:Ago4	APN	4	126515884	splice site	probably null
IGL01943:Ago4	APN	4	126517195	missense	probably damaging	1.00
IGL02079:Ago4	APN	4	126517084	missense	probably damaging	0.99
IGL02117:Ago4	APN	4	126516852	missense	probably benign	0.00
IGL02229:Ago4	APN	4	126511532	missense	probably benign	0.34
IGL02503:Ago4	APN	4	126496805	nonsense	probably null
IGL02504:Ago4	APN	4	126517439	missense	probably benign	0.00
IGL02975:Ago4	APN	4	126512519	critical splice donor site	probably null
BB020:Ago4	UTSW	4	126507018	missense	probably benign	0.22
IGL02837:Ago4	UTSW	4	126497300	missense	possibly damaging	0.73
R0129:Ago4	UTSW	4	126517183	missense	possibly damaging	0.85
R0142:Ago4	UTSW	4	126516932	missense	probably benign	0.24
R0480:Ago4	UTSW	4	126526077	missense	probably benign	0.00
R0533:Ago4	UTSW	4	126516860	missense	probably benign	0.00
R1014:Ago4	UTSW	4	126506785	missense	probably damaging	1.00
R1350:Ago4	UTSW	4	126507132	missense	probably benign	0.04
R1547:Ago4	UTSW	4	126511413	missense	probably benign	0.01
R1894:Ago4	UTSW	4	126512600	missense	probably benign	0.11
R1900:Ago4	UTSW	4	126516936	missense	probably benign	0.00
R2510:Ago4	UTSW	4	126517071	missense	probably damaging	1.00
R2511:Ago4	UTSW	4	126517071	missense	probably damaging	1.00
R4063:Ago4	UTSW	4	126515862	intron	probably benign
R4064:Ago4	UTSW	4	126515862	intron	probably benign
R4120:Ago4	UTSW	4	126496807	missense	probably damaging	1.00
R4916:Ago4	UTSW	4	126506842	missense	probably damaging	1.00
R4917:Ago4	UTSW	4	126506842	missense	probably damaging	1.00
R4918:Ago4	UTSW	4	126506842	missense	probably damaging	1.00
R4941:Ago4	UTSW	4	126526054	missense	probably benign	0.00
R5169:Ago4	UTSW	4	126511727	missense	probably benign	0.06
R5262:Ago4	UTSW	4	126496764	missense	possibly damaging	0.66
R5385:Ago4	UTSW	4	126517556	missense	probably benign
R5757:Ago4	UTSW	4	126526084	missense	probably damaging	1.00
R6244:Ago4	UTSW	4	126511487	missense	possibly damaging	0.67
R6256:Ago4	UTSW	4	126520226	missense	probably damaging	1.00
R6389:Ago4	UTSW	4	126507244	missense	probably damaging	1.00
R6545:Ago4	UTSW	4	126512018	missense	probably benign	0.10
R7378:Ago4	UTSW	4	126511464	missense	probably benign
R7804:Ago4	UTSW	4	126512630	missense	probably benign	0.02
R7890:Ago4	UTSW	4	126526076	missense	probably benign	0.00
R7933:Ago4	UTSW	4	126507018	missense	probably benign	0.22
R8824:Ago4	UTSW	4	126507184	missense	probably benign	0.04
R8852:Ago4	UTSW	4	126493250	missense	probably benign	0.03
R8860:Ago4	UTSW	4	126493250	missense	probably benign	0.03
R9023:Ago4	UTSW	4	126506803	missense	probably damaging	1.00
R9127:Ago4	UTSW	4	126507111	missense	probably damaging	1.00
R9138:Ago4	UTSW	4	126520280	nonsense	probably null
R9447:Ago4	UTSW	4	126508358	missense	probably benign	0.13
X0062:Ago4	UTSW	4	126515941	missense	probably benign	0.00
X0064:Ago4	UTSW	4	126517482	missense	possibly damaging	0.87
Z1176:Ago4	UTSW	4	126520190	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- TTCGAATTGCTATTAGCTCCGGC -3'
(R):5'- CTTCTATTGCAGCCGTGGTG -3'

Sequencing Primer
(F):5'- TGCTATTAGCTCCGGCCAAGC -3'
(R):5'- ATCCCAGCCGGTACTGTG -3'

Posted On

2020-08-01