Mutagenetix > Incidental Mutations

Incidental Mutation 'BB010:Camta1'

642574

Institutional Source

Beutler Lab

Gene Symbol

Camta1

Ensembl Gene

ENSMUSG00000014592

Gene Name

calmodulin binding transcription activator 1

Synonyms

1810059M14Rik, 2310058O09Rik

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.631) question?

Stock #

BB010

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

150917322-151861876 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 151083757 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Lysine at position 279 (E279K)

Ref Sequence

ENSEMBL: ENSMUSP00000101295 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049790] [ENSMUST00000097774] [ENSMUST00000105668] [ENSMUST00000105670] [ENSMUST00000131948] [ENSMUST00000140030] [ENSMUST00000169423]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000049790
AA Change: E1370K

PolyPhen 2 Score 0.918 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000054804
Gene: ENSMUSG00000014592
AA Change: E1370K

Domain	Start	End	E-Value	Type
CG-1	67	183	1.39e-91	SMART
low complexity region	550	583	N/A	INTRINSIC
low complexity region	677	688	N/A	INTRINSIC
Pfam:TIG	874	954	3e-13	PFAM
low complexity region	997	1030	N/A	INTRINSIC
ANK	1066	1095	1.7e2	SMART
ANK	1111	1141	4.73e2	SMART
low complexity region	1301	1319	N/A	INTRINSIC
IQ	1548	1564	2.38e2	SMART
IQ	1578	1600	5.42e0	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000097774
AA Change: E1370K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000095381
Gene: ENSMUSG00000014592
AA Change: E1370K

Domain	Start	End	E-Value	Type
CG-1	67	183	1.39e-91	SMART
low complexity region	550	583	N/A	INTRINSIC
low complexity region	677	688	N/A	INTRINSIC
Pfam:TIG	874	954	3.1e-11	PFAM
low complexity region	997	1030	N/A	INTRINSIC
ANK	1066	1095	1.7e2	SMART
ANK	1111	1141	4.73e2	SMART
low complexity region	1301	1319	N/A	INTRINSIC
IQ	1548	1570	5.45e1	SMART
IQ	1571	1593	5.42e0	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000105668
AA Change: E279K

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000101293
Gene: ENSMUSG00000014592
AA Change: E279K

Domain	Start	End	E-Value	Type
low complexity region	19	52	N/A	INTRINSIC
ANK	88	117	1.7e2	SMART
ANK	133	163	4.73e2	SMART
Blast:ANK	167	197	6e-10	BLAST
IQ	457	473	2.38e2	SMART
IQ	487	509	5.42e0	SMART
Pfam:IQ	512	527	5.1e-4	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000105670
AA Change: E279K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000101295
Gene: ENSMUSG00000014592
AA Change: E279K

Domain	Start	End	E-Value	Type
low complexity region	19	52	N/A	INTRINSIC
ANK	88	117	1.7e2	SMART
ANK	133	163	4.73e2	SMART
Blast:ANK	167	197	5e-10	BLAST
IQ	457	479	5.45e1	SMART
IQ	480	502	5.42e0	SMART
Pfam:IQ	505	520	5.1e-4	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000131948

SMART Domains

Protein: ENSMUSP00000118969
Gene: ENSMUSG00000014592

Domain	Start	End	E-Value	Type
low complexity region	19	52	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000140030

SMART Domains

Protein: ENSMUSP00000119067
Gene: ENSMUSG00000014592

Domain	Start	End	E-Value	Type
IQ	111	133	5.45e1	SMART
IQ	134	156	5.42e0	SMART
Pfam:IQ	159	174	8.5e-4	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000169423
AA Change: E1370K

PolyPhen 2 Score 0.918 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000127916
Gene: ENSMUSG00000014592
AA Change: E1370K

Domain	Start	End	E-Value	Type
CG-1	67	183	1.39e-91	SMART
low complexity region	550	583	N/A	INTRINSIC
low complexity region	677	688	N/A	INTRINSIC
Pfam:TIG	874	954	3.1e-11	PFAM
low complexity region	997	1030	N/A	INTRINSIC
ANK	1066	1095	1.7e2	SMART
ANK	1111	1141	4.73e2	SMART
low complexity region	1301	1319	N/A	INTRINSIC
IQ	1548	1564	2.38e2	SMART
IQ	1578	1600	5.42e0	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Global or nervous system deletion of this gene results in decreased body size, severe ataxia, progressive Purkinje cell degeneration, and cerebellar atrophy. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	A	G	13: 59,743,751	L85P	probably damaging	Het
4933414I15Rik	A	G	11: 50,942,400	V125A	unknown	Het
Adam34	T	A	8: 43,650,874	H578L	probably damaging	Het
Ago4	A	T	4: 126,507,018	M678K	probably benign	Het
Atrn	T	C	2: 130,995,066	L1150P	probably damaging	Het
Ccdc88c	T	C	12: 100,945,490	D695G	possibly damaging	Het
Col11a2	A	T	17: 34,056,055	K400*	probably null	Het
Cpsf4	T	A	5: 145,167,358	M1K	probably null	Het
Dnah12	A	T	14: 26,766,115	Q992L	probably benign	Het
Dnajc7	T	C	11: 100,596,212	Y145C	probably damaging	Het
Eml5	A	T	12: 98,844,020	D892E	possibly damaging	Het
Fam193a	A	G	5: 34,466,195	K23E	possibly damaging	Het
Fam214b	A	T	4: 43,035,919	C271S	probably benign	Het
Filip1	T	G	9: 79,820,047	K430T	possibly damaging	Het
Gm5089	T	C	14: 122,435,991	D106G	unknown	Het
Hip1	A	T	5: 135,460,456	N45K	probably damaging	Het
Hivep2	T	C	10: 14,127,837	S60P	probably damaging	Het
Ighv1-53	A	T	12: 115,158,409	C115*	probably null	Het
Macf1	T	C	4: 123,409,651	T353A	probably benign	Het
Mast3	A	T	8: 70,786,635	V433E	probably damaging	Het
Mast4	A	T	13: 102,772,563	M660K	probably damaging	Het
Nr2e1	T	C	10: 42,563,383	Y380C	probably damaging	Het
Olfr1465	T	A	19: 13,314,205	M27L	probably benign	Het
Olfr980	T	C	9: 40,007,135		probably benign	Het
Otog	A	G	7: 46,310,147	D720G	probably damaging	Het
Slc6a1	T	A	6: 114,311,898	W473R	probably damaging	Het
Smpd3	A	C	8: 106,255,622	C617G	probably benign	Het
Sprr3	T	C	3: 92,457,208	I110V	possibly damaging	Het
Ston1	A	G	17: 88,636,144	E326G	probably benign	Het
Tapbpl	T	G	6: 125,230,270	Q152P	probably damaging	Het
Tectb	C	T	19: 55,194,673	L319F	possibly damaging	Het
Tpp2	G	A	1: 43,960,961	G413D	probably damaging	Het
Tpsg1	A	G	17: 25,373,204	H84R	probably damaging	Het
Usp24	A	G	4: 106,428,489	N2437S	probably benign	Het
Usp32	T	C	11: 85,007,059	Q1152R	probably damaging	Het
Vmn2r6	T	C	3: 64,559,803	T92A	probably benign	Het
Xpo7	A	G	14: 70,707,348	V35A	probably benign	Het
Zan	T	A	5: 137,463,579	T1113S	unknown	Het
Zfp169	A	G	13: 48,490,481	V390A	unknown	Het

Other mutations in Camta1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00552:Camta1	APN	4	151071424	critical splice donor site	probably null
IGL00823:Camta1	APN	4	151084601	missense	probably benign	0.02
IGL01361:Camta1	APN	4	151144692	missense	probably damaging	1.00
IGL01523:Camta1	APN	4	151145050	missense	possibly damaging	0.73
IGL01730:Camta1	APN	4	151062845	missense	probably damaging	0.99
IGL02045:Camta1	APN	4	151073985	splice site	probably null
IGL02541:Camta1	APN	4	151084655	missense	probably benign	0.12
IGL02839:Camta1	APN	4	151144512	missense	probably damaging	1.00
IGL03012:Camta1	APN	4	151453299	missense	probably damaging	1.00
Bonus	UTSW	4	151138375	missense	probably damaging	1.00
BB020:Camta1	UTSW	4	151083757	missense	probably damaging	0.99
PIT4449001:Camta1	UTSW	4	151131586	missense	probably benign	0.00
R0136:Camta1	UTSW	4	151078969	missense	probably damaging	0.99
R0239:Camta1	UTSW	4	151143730	missense	probably damaging	1.00
R0239:Camta1	UTSW	4	151143730	missense	probably damaging	1.00
R0276:Camta1	UTSW	4	151075140	missense	probably damaging	1.00
R0346:Camta1	UTSW	4	151075140	missense	probably damaging	1.00
R0347:Camta1	UTSW	4	151075140	missense	probably damaging	1.00
R0348:Camta1	UTSW	4	151586431	missense	possibly damaging	0.64
R0385:Camta1	UTSW	4	151075140	missense	probably damaging	1.00
R0386:Camta1	UTSW	4	151075140	missense	probably damaging	1.00
R0388:Camta1	UTSW	4	151075140	missense	probably damaging	1.00
R0410:Camta1	UTSW	4	151075140	missense	probably damaging	1.00
R0456:Camta1	UTSW	4	151075140	missense	probably damaging	1.00
R0478:Camta1	UTSW	4	151075140	missense	probably damaging	1.00
R0510:Camta1	UTSW	4	151075140	missense	probably damaging	1.00
R0511:Camta1	UTSW	4	151075140	missense	probably damaging	1.00
R0683:Camta1	UTSW	4	151075140	missense	probably damaging	1.00
R0724:Camta1	UTSW	4	151077892	missense	probably damaging	1.00
R0732:Camta1	UTSW	4	151586484	critical splice acceptor site	probably null
R1549:Camta1	UTSW	4	151586463	missense	probably damaging	1.00
R1670:Camta1	UTSW	4	151079771	missense	probably benign	0.00
R1704:Camta1	UTSW	4	151075224	missense	probably damaging	1.00
R1718:Camta1	UTSW	4	151084024	missense	probably benign	0.00
R1941:Camta1	UTSW	4	151075155	missense	probably damaging	1.00
R1967:Camta1	UTSW	4	151088973	missense	probably damaging	0.99
R1998:Camta1	UTSW	4	151077880	missense	probably damaging	1.00
R2081:Camta1	UTSW	4	151144242	missense	probably benign	0.24
R2104:Camta1	UTSW	4	151453294	missense	probably damaging	0.99
R2240:Camta1	UTSW	4	151084575	missense	possibly damaging	0.66
R4516:Camta1	UTSW	4	151144720	missense	possibly damaging	0.90
R4539:Camta1	UTSW	4	151084812	missense	probably benign	0.03
R4552:Camta1	UTSW	4	151792502	missense	probably damaging	0.96
R4610:Camta1	UTSW	4	151084827	missense	probably damaging	1.00
R4658:Camta1	UTSW	4	151143910	missense	probably damaging	1.00
R4725:Camta1	UTSW	4	151148496	missense	probably benign	0.11
R4786:Camta1	UTSW	4	151290039	missense	probably damaging	1.00
R4812:Camta1	UTSW	4	151131542	missense	probably null	0.25
R4840:Camta1	UTSW	4	151144407	missense	probably benign	0.23
R5038:Camta1	UTSW	4	151145469	missense	probably damaging	1.00
R5112:Camta1	UTSW	4	151074054	missense	probably damaging	1.00
R5251:Camta1	UTSW	4	151163884	missense	probably damaging	1.00
R5388:Camta1	UTSW	4	151075238	missense	probably damaging	1.00
R5487:Camta1	UTSW	4	151144754	missense	possibly damaging	0.73
R6343:Camta1	UTSW	4	151079849	missense	probably damaging	0.98
R6462:Camta1	UTSW	4	151086164	missense	probably damaging	0.98
R6550:Camta1	UTSW	4	151138375	missense	probably damaging	1.00
R6990:Camta1	UTSW	4	151145044	missense	probably damaging	0.97
R7165:Camta1	UTSW	4	151084700	missense	possibly damaging	0.63
R7190:Camta1	UTSW	4	151148523	missense	possibly damaging	0.57
R7215:Camta1	UTSW	4	151144737	missense	probably damaging	1.00
R7264:Camta1	UTSW	4	151453399	missense	probably damaging	1.00
R7403:Camta1	UTSW	4	151453295	nonsense	probably null
R7445:Camta1	UTSW	4	151144291	missense	possibly damaging	0.94
R7447:Camta1	UTSW	4	151083870	missense	probably benign	0.31
R7585:Camta1	UTSW	4	151144830	missense	probably damaging	1.00
R7751:Camta1	UTSW	4	151148406	splice site	probably null
R7881:Camta1	UTSW	4	151835876	missense	probably damaging	0.99
R7933:Camta1	UTSW	4	151083757	missense	probably damaging	0.99
R7960:Camta1	UTSW	4	151148533	missense	probably benign	0.01
R8057:Camta1	UTSW	4	151144032	missense	probably damaging	1.00
R8073:Camta1	UTSW	4	151078824	missense	probably damaging	1.00
R8241:Camta1	UTSW	4	151083825	missense	probably benign	0.00
R8247:Camta1	UTSW	4	151075264	missense	probably damaging	1.00
R8466:Camta1	UTSW	4	151086120	nonsense	probably null
X0063:Camta1	UTSW	4	151145247	missense	probably damaging	1.00
Z1176:Camta1	UTSW	4	151144385	missense	probably benign	0.06
Z1177:Camta1	UTSW	4	151077925	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTGTGACTCTTCCTGGGATG -3'
(R):5'- AGAGACTGCAGCATCCCAAG -3'

Sequencing Primer
(F):5'- ACTCTTCCTGGGATGGGGAC -3'
(R):5'- AAGCGTCTGCATCTCAGC -3'

Posted On

2020-08-01