Incidental Mutation 'BB010:Cpsf4'
ID642578
Institutional Source Beutler Lab
Gene Symbol Cpsf4
Ensembl Gene ENSMUSG00000029625
Gene Namecleavage and polyadenylation specific factor 4
Synonyms30kDa
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.936) question?
Stock #BB010
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location145167213-145182041 bp(+) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) T to A at 145167358 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1 (M1K)
Ref Sequence ENSEMBL: ENSMUSP00000124899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031628] [ENSMUST00000070487] [ENSMUST00000160422] [ENSMUST00000160574] [ENSMUST00000160629] [ENSMUST00000161390] [ENSMUST00000162244]
Predicted Effect probably benign
Transcript: ENSMUST00000031628
SMART Domains Protein: ENSMUSP00000031628
Gene: ENSMUSG00000029624

DomainStartEndE-ValueType
low complexity region 48 58 N/A INTRINSIC
low complexity region 64 74 N/A INTRINSIC
low complexity region 110 123 N/A INTRINSIC
Pfam:PPR_2 169 218 1.2e-16 PFAM
Pfam:PPR 172 202 1.1e-9 PFAM
Pfam:PPR_3 173 204 2.5e-5 PFAM
Pfam:PPR_3 245 278 3.2e-5 PFAM
Pfam:PPR 246 276 6.5e-4 PFAM
internal_repeat_1 437 595 1.57e-9 PROSPERO
Predicted Effect probably null
Transcript: ENSMUST00000070487
AA Change: M1K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000069243
Gene: ENSMUSG00000029625
AA Change: M1K

DomainStartEndE-ValueType
ZnF_C3H1 35 61 1.7e-5 SMART
ZnF_C3H1 62 88 1.4e-10 SMART
ZnF_C3H1 90 110 3.7e-1 SMART
ZnF_C3H1 111 136 3.4e-9 SMART
low complexity region 143 157 N/A INTRINSIC
ZnF_C2HC 186 202 4.5e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000160422
AA Change: M1K

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000125019
Gene: ENSMUSG00000029625
AA Change: M1K

DomainStartEndE-ValueType
ZnF_C3H1 35 61 4.17e-3 SMART
ZnF_C3H1 62 88 3.41e-8 SMART
ZnF_C3H1 90 116 6.42e-4 SMART
ZnF_C3H1 118 142 2.86e-1 SMART
ZnF_C3H1 143 168 8.27e-7 SMART
low complexity region 175 191 N/A INTRINSIC
ZnF_C2HC 244 260 1.04e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000160574
AA Change: M1K

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
Predicted Effect probably null
Transcript: ENSMUST00000160629
AA Change: M1K

PolyPhen 2 Score 0.771 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000124899
Gene: ENSMUSG00000029625
AA Change: M1K

DomainStartEndE-ValueType
ZnF_C3H1 35 61 4.17e-3 SMART
ZnF_C3H1 62 88 3.41e-8 SMART
ZnF_C3H1 90 116 6.42e-4 SMART
ZnF_C3H1 118 142 2.86e-1 SMART
ZnF_C3H1 143 168 8.27e-7 SMART
low complexity region 175 189 N/A INTRINSIC
ZnF_C2HC 218 234 1.04e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160762
SMART Domains Protein: ENSMUSP00000125640
Gene: ENSMUSG00000029625

DomainStartEndE-ValueType
ZnF_C3H1 3 29 4.17e-3 SMART
ZnF_C3H1 30 56 3.41e-8 SMART
ZnF_C3H1 58 84 6.42e-4 SMART
ZnF_C3H1 86 110 2.86e-1 SMART
ZnF_C3H1 111 136 8.27e-7 SMART
low complexity region 143 157 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161390
Predicted Effect probably null
Transcript: ENSMUST00000162244
AA Change: M1K

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000124966
Gene: ENSMUSG00000029625
AA Change: M1K

DomainStartEndE-ValueType
ZnF_C3H1 35 61 4.17e-3 SMART
ZnF_C3H1 62 88 3.41e-8 SMART
ZnF_C3H1 90 116 6.42e-4 SMART
ZnF_C3H1 118 142 2.86e-1 SMART
ZnF_C3H1 143 168 8.27e-7 SMART
low complexity region 175 195 N/A INTRINSIC
ZnF_C2HC 219 235 1.04e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Inhibition of the nuclear export of poly(A)-containing mRNAs caused by the influenza A virus NS1 protein requires its effector domain. The NS1 effector domain functionally interacts with the cellular 30 kDa subunit of cleavage and polyadenylation specific factor 4, an essential component of the 3' end processing machinery of cellular pre-mRNAs. In influenza virus-infected cells, the NS1 protein is physically associated with cleavage and polyadenylation specific factor 4, 30kD subunit. Binding of the NS1 protein to the 30 kDa protein in vitro prevents CPSF binding to the RNA substrate and inhibits 3' end cleavage and polyadenylation of host pre-mRNAs. Thus the NS1 protein selectively inhibits the nuclear export of cellular, and not viral, mRNAs. Multiple alternatively spliced transcript variants that encode different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A G 13: 59,743,751 L85P probably damaging Het
4933414I15Rik A G 11: 50,942,400 V125A unknown Het
Adam34 T A 8: 43,650,874 H578L probably damaging Het
Ago4 A T 4: 126,507,018 M678K probably benign Het
Atrn T C 2: 130,995,066 L1150P probably damaging Het
Camta1 C T 4: 151,083,757 E279K probably damaging Het
Ccdc88c T C 12: 100,945,490 D695G possibly damaging Het
Col11a2 A T 17: 34,056,055 K400* probably null Het
Dnah12 A T 14: 26,766,115 Q992L probably benign Het
Dnajc7 T C 11: 100,596,212 Y145C probably damaging Het
Eml5 A T 12: 98,844,020 D892E possibly damaging Het
Fam193a A G 5: 34,466,195 K23E possibly damaging Het
Fam214b A T 4: 43,035,919 C271S probably benign Het
Filip1 T G 9: 79,820,047 K430T possibly damaging Het
Gm5089 T C 14: 122,435,991 D106G unknown Het
Hip1 A T 5: 135,460,456 N45K probably damaging Het
Hivep2 T C 10: 14,127,837 S60P probably damaging Het
Ighv1-53 A T 12: 115,158,409 C115* probably null Het
Macf1 T C 4: 123,409,651 T353A probably benign Het
Mast3 A T 8: 70,786,635 V433E probably damaging Het
Mast4 A T 13: 102,772,563 M660K probably damaging Het
Nr2e1 T C 10: 42,563,383 Y380C probably damaging Het
Olfr1465 T A 19: 13,314,205 M27L probably benign Het
Olfr980 T C 9: 40,007,135 probably benign Het
Otog A G 7: 46,310,147 D720G probably damaging Het
Slc6a1 T A 6: 114,311,898 W473R probably damaging Het
Smpd3 A C 8: 106,255,622 C617G probably benign Het
Sprr3 T C 3: 92,457,208 I110V possibly damaging Het
Ston1 A G 17: 88,636,144 E326G probably benign Het
Tapbpl T G 6: 125,230,270 Q152P probably damaging Het
Tectb C T 19: 55,194,673 L319F possibly damaging Het
Tpp2 G A 1: 43,960,961 G413D probably damaging Het
Tpsg1 A G 17: 25,373,204 H84R probably damaging Het
Usp24 A G 4: 106,428,489 N2437S probably benign Het
Usp32 T C 11: 85,007,059 Q1152R probably damaging Het
Vmn2r6 T C 3: 64,559,803 T92A probably benign Het
Xpo7 A G 14: 70,707,348 V35A probably benign Het
Zan T A 5: 137,463,579 T1113S unknown Het
Zfp169 A G 13: 48,490,481 V390A unknown Het
Other mutations in Cpsf4
AlleleSourceChrCoordTypePredicted EffectPPH Score
BB020:Cpsf4 UTSW 5 145167358 start codon destroyed probably null 0.77
R0446:Cpsf4 UTSW 5 145177244 missense probably damaging 1.00
R2144:Cpsf4 UTSW 5 145178762 missense probably benign 0.00
R5813:Cpsf4 UTSW 5 145178873 missense probably benign
R6958:Cpsf4 UTSW 5 145175592 missense probably benign 0.22
R7037:Cpsf4 UTSW 5 145176129 missense possibly damaging 0.51
R7933:Cpsf4 UTSW 5 145167358 start codon destroyed probably null 0.77
R8814:Cpsf4 UTSW 5 145178868 missense probably benign 0.03
Z1176:Cpsf4 UTSW 5 145167415 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- TAGTCAGGCCTGAAGGAGTG -3'
(R):5'- TCTCCCCGAGTTCAAGTGACAC -3'

Sequencing Primer
(F):5'- ACTCTGAGCTCCGTTGGCTG -3'
(R):5'- TTCAAGTGACACCGGGAAGTCC -3'
Posted On2020-08-01