Incidental Mutation 'BB010:Olfr980'
ID642585
Institutional Source Beutler Lab
Gene Symbol Olfr980
Ensembl Gene ENSMUSG00000060254
Gene Nameolfactory receptor 980
SynonymsMOR223-2, GA_x6K02T2PVTD-33705428-33704496
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #BB010
Quality Score104.009
Status Not validated
Chromosome9
Chromosomal Location40004348-40009582 bp(-) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) T to C at 40007135 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000150496 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073932] [ENSMUST00000215523] [ENSMUST00000216463]
Predicted Effect probably benign
Transcript: ENSMUST00000073932
SMART Domains Protein: ENSMUSP00000091386
Gene: ENSMUSG00000060254

DomainStartEndE-ValueType
Pfam:7tm_4 29 304 1.4e-55 PFAM
Pfam:7tm_1 39 287 5.4e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215523
Predicted Effect probably benign
Transcript: ENSMUST00000216463
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A G 13: 59,743,751 L85P probably damaging Het
4933414I15Rik A G 11: 50,942,400 V125A unknown Het
Adam34 T A 8: 43,650,874 H578L probably damaging Het
Ago4 A T 4: 126,507,018 M678K probably benign Het
Atrn T C 2: 130,995,066 L1150P probably damaging Het
Camta1 C T 4: 151,083,757 E279K probably damaging Het
Ccdc88c T C 12: 100,945,490 D695G possibly damaging Het
Col11a2 A T 17: 34,056,055 K400* probably null Het
Cpsf4 T A 5: 145,167,358 M1K probably null Het
Dnah12 A T 14: 26,766,115 Q992L probably benign Het
Dnajc7 T C 11: 100,596,212 Y145C probably damaging Het
Eml5 A T 12: 98,844,020 D892E possibly damaging Het
Fam193a A G 5: 34,466,195 K23E possibly damaging Het
Fam214b A T 4: 43,035,919 C271S probably benign Het
Filip1 T G 9: 79,820,047 K430T possibly damaging Het
Gm5089 T C 14: 122,435,991 D106G unknown Het
Hip1 A T 5: 135,460,456 N45K probably damaging Het
Hivep2 T C 10: 14,127,837 S60P probably damaging Het
Ighv1-53 A T 12: 115,158,409 C115* probably null Het
Macf1 T C 4: 123,409,651 T353A probably benign Het
Mast3 A T 8: 70,786,635 V433E probably damaging Het
Mast4 A T 13: 102,772,563 M660K probably damaging Het
Nr2e1 T C 10: 42,563,383 Y380C probably damaging Het
Olfr1465 T A 19: 13,314,205 M27L probably benign Het
Otog A G 7: 46,310,147 D720G probably damaging Het
Slc6a1 T A 6: 114,311,898 W473R probably damaging Het
Smpd3 A C 8: 106,255,622 C617G probably benign Het
Sprr3 T C 3: 92,457,208 I110V possibly damaging Het
Ston1 A G 17: 88,636,144 E326G probably benign Het
Tapbpl T G 6: 125,230,270 Q152P probably damaging Het
Tectb C T 19: 55,194,673 L319F possibly damaging Het
Tpp2 G A 1: 43,960,961 G413D probably damaging Het
Tpsg1 A G 17: 25,373,204 H84R probably damaging Het
Usp24 A G 4: 106,428,489 N2437S probably benign Het
Usp32 T C 11: 85,007,059 Q1152R probably damaging Het
Vmn2r6 T C 3: 64,559,803 T92A probably benign Het
Xpo7 A G 14: 70,707,348 V35A probably benign Het
Zan T A 5: 137,463,579 T1113S unknown Het
Zfp169 A G 13: 48,490,481 V390A unknown Het
Other mutations in Olfr980
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02256:Olfr980 APN 9 40006053 missense probably benign
IGL02378:Olfr980 APN 9 40006473 missense probably damaging 1.00
IGL03384:Olfr980 APN 9 40006470 missense probably benign
IGL03402:Olfr980 APN 9 40006506 missense probably benign 0.31
PIT4651001:Olfr980 UTSW 9 40006230 missense probably damaging 0.97
R0013:Olfr980 UTSW 9 40006355 missense probably damaging 1.00
R1146:Olfr980 UTSW 9 40006094 missense possibly damaging 0.95
R1146:Olfr980 UTSW 9 40006094 missense possibly damaging 0.95
R4541:Olfr980 UTSW 9 40006293 missense possibly damaging 0.95
R4562:Olfr980 UTSW 9 40006281 missense probably damaging 0.99
R4731:Olfr980 UTSW 9 40006268 missense probably damaging 1.00
R4732:Olfr980 UTSW 9 40006268 missense probably damaging 1.00
R4733:Olfr980 UTSW 9 40006268 missense probably damaging 1.00
R4825:Olfr980 UTSW 9 40006742 missense possibly damaging 0.72
R5619:Olfr980 UTSW 9 40006743 missense probably benign 0.07
R5770:Olfr980 UTSW 9 40006338 missense probably benign 0.01
R5791:Olfr980 UTSW 9 40006734 missense probably damaging 1.00
R6813:Olfr980 UTSW 9 40006457 missense probably benign
R6819:Olfr980 UTSW 9 40006548 missense probably benign 0.00
R6970:Olfr980 UTSW 9 40006713 missense probably benign 0.00
R7490:Olfr980 UTSW 9 40006424 missense probably damaging 1.00
R7511:Olfr980 UTSW 9 40006933 missense possibly damaging 0.63
R7933:Olfr980 UTSW 9 40007135 start gained probably benign
R8243:Olfr980 UTSW 9 40006188 missense probably benign 0.19
Z1088:Olfr980 UTSW 9 40006596 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGAAGAACGTGGTCACTACAC -3'
(R):5'- TATGATATGGTGCCTTGATGCTAC -3'

Sequencing Primer
(F):5'- ACGTGGTCACTACACTTCCATTTAAC -3'
(R):5'- TGCCTTGATGCTACTCAAGAG -3'
Posted On2020-08-01