Mutagenetix > Incidental Mutations

Incidental Mutation 'BB010:Eml5'

642592

Institutional Source

Beutler Lab

Gene Symbol

Eml5

Ensembl Gene

ENSMUSG00000051166

Gene Name

echinoderm microtubule associated protein like 5

Synonyms

C130068M19Rik

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.334) question?

Stock #

BB010

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

98786805-98901484 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 98844020 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 892 (D892E)

Ref Sequence

ENSEMBL: ENSMUSP00000152709 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065716] [ENSMUST00000223282]

AlphaFold

Q8BQM8

Predicted Effect

probably benign
Transcript: ENSMUST00000065716
AA Change: D853E

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000065643
Gene: ENSMUSG00000051166
AA Change: D853E

Domain	Start	End	E-Value	Type
Pfam:HELP	1	49	3.3e-21	PFAM
WD40	50	91	6.42e-1	SMART
WD40	94	136	1.08e-4	SMART
WD40	139	178	1.27e-1	SMART
WD40	184	224	2.75e1	SMART
WD40	225	263	2.65e-4	SMART
Blast:WD40	265	312	2e-22	BLAST
WD40	313	353	4.69e-5	SMART
WD40	356	394	2.2e2	SMART
WD40	397	436	8.59e-1	SMART
WD40	444	479	6.6e1	SMART
WD40	505	546	2.74e2	SMART
WD40	552	592	4.8e-2	SMART
low complexity region	609	632	N/A	INTRINSIC
Pfam:HELP	656	715	1.4e-20	PFAM
WD40	716	757	1.18e-1	SMART
WD40	760	802	2.84e-4	SMART
WD40	805	844	1.91e1	SMART
WD40	853	891	2.64e2	SMART
WD40	892	929	3.45e-3	SMART
WD40	985	1026	4.55e-3	SMART
WD40	1029	1068	6.39e0	SMART
WD40	1071	1111	5.15e-2	SMART
WD40	1180	1221	1.9e2	SMART
WD40	1227	1267	1.38e0	SMART
low complexity region	1280	1297	N/A	INTRINSIC
Pfam:HELP	1335	1410	2.4e-16	PFAM
Blast:WD40	1412	1462	8e-28	BLAST
WD40	1465	1507	1.56e-1	SMART
WD40	1510	1549	2.06e0	SMART
WD40	1558	1597	8.22e1	SMART
WD40	1599	1644	4.26e1	SMART
WD40	1690	1730	2.19e-5	SMART
WD40	1774	1813	5.97e-1	SMART
WD40	1884	1925	2.39e0	SMART
WD40	1931	1971	2.88e-1	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000223282
AA Change: D892E

PolyPhen 2 Score 0.874 (Sensitivity: 0.83; Specificity: 0.93)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	A	G	13: 59,743,751	L85P	probably damaging	Het
4933414I15Rik	A	G	11: 50,942,400	V125A	unknown	Het
Adam34	T	A	8: 43,650,874	H578L	probably damaging	Het
Ago4	A	T	4: 126,507,018	M678K	probably benign	Het
Atrn	T	C	2: 130,995,066	L1150P	probably damaging	Het
Camta1	C	T	4: 151,083,757	E279K	probably damaging	Het
Ccdc88c	T	C	12: 100,945,490	D695G	possibly damaging	Het
Col11a2	A	T	17: 34,056,055	K400*	probably null	Het
Cpsf4	T	A	5: 145,167,358	M1K	probably null	Het
Dnah12	A	T	14: 26,766,115	Q992L	probably benign	Het
Dnajc7	T	C	11: 100,596,212	Y145C	probably damaging	Het
Fam193a	A	G	5: 34,466,195	K23E	possibly damaging	Het
Fam214b	A	T	4: 43,035,919	C271S	probably benign	Het
Filip1	T	G	9: 79,820,047	K430T	possibly damaging	Het
Gm5089	T	C	14: 122,435,991	D106G	unknown	Het
Hip1	A	T	5: 135,460,456	N45K	probably damaging	Het
Hivep2	T	C	10: 14,127,837	S60P	probably damaging	Het
Ighv1-53	A	T	12: 115,158,409	C115*	probably null	Het
Macf1	T	C	4: 123,409,651	T353A	probably benign	Het
Mast3	A	T	8: 70,786,635	V433E	probably damaging	Het
Mast4	A	T	13: 102,772,563	M660K	probably damaging	Het
Nr2e1	T	C	10: 42,563,383	Y380C	probably damaging	Het
Olfr1465	T	A	19: 13,314,205	M27L	probably benign	Het
Olfr980	T	C	9: 40,007,135		probably benign	Het
Otog	A	G	7: 46,310,147	D720G	probably damaging	Het
Slc6a1	T	A	6: 114,311,898	W473R	probably damaging	Het
Smpd3	A	C	8: 106,255,622	C617G	probably benign	Het
Sprr3	T	C	3: 92,457,208	I110V	possibly damaging	Het
Ston1	A	G	17: 88,636,144	E326G	probably benign	Het
Tapbpl	T	G	6: 125,230,270	Q152P	probably damaging	Het
Tectb	C	T	19: 55,194,673	L319F	possibly damaging	Het
Tpp2	G	A	1: 43,960,961	G413D	probably damaging	Het
Tpsg1	A	G	17: 25,373,204	H84R	probably damaging	Het
Usp24	A	G	4: 106,428,489	N2437S	probably benign	Het
Usp32	T	C	11: 85,007,059	Q1152R	probably damaging	Het
Vmn2r6	T	C	3: 64,559,803	T92A	probably benign	Het
Xpo7	A	G	14: 70,707,348	V35A	probably benign	Het
Zan	T	A	5: 137,463,579	T1113S	unknown	Het
Zfp169	A	G	13: 48,490,481	V390A	unknown	Het

Other mutations in Eml5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00091:Eml5	APN	12	98873209	splice site	probably benign
IGL00473:Eml5	APN	12	98805492	splice site	probably benign
IGL01120:Eml5	APN	12	98844019	missense	probably benign
IGL01308:Eml5	APN	12	98802313	missense	probably damaging	1.00
IGL01790:Eml5	APN	12	98798932	missense	probably damaging	1.00
IGL01973:Eml5	APN	12	98863280	missense	probably benign
IGL02182:Eml5	APN	12	98802322	missense	probably damaging	1.00
IGL02201:Eml5	APN	12	98794424	splice site	probably benign
IGL02375:Eml5	APN	12	98844087	missense	probably damaging	1.00
IGL02397:Eml5	APN	12	98790674	missense	probably benign	0.07
IGL02480:Eml5	APN	12	98876243	missense	probably damaging	1.00
IGL02801:Eml5	APN	12	98817845	missense	possibly damaging	0.88
IGL02876:Eml5	APN	12	98858841	missense	probably damaging	1.00
IGL03104:Eml5	APN	12	98861245	nonsense	probably null
IGL03158:Eml5	APN	12	98827514	splice site	probably benign
IGL03286:Eml5	APN	12	98860503	missense	probably damaging	1.00
IGL03380:Eml5	APN	12	98874647	splice site	probably benign
BB020:Eml5	UTSW	12	98844020	missense	possibly damaging	0.87
R0573:Eml5	UTSW	12	98824772	splice site	probably null
R0624:Eml5	UTSW	12	98865479	missense	probably damaging	1.00
R0993:Eml5	UTSW	12	98861183	missense	probably benign	0.25
R1073:Eml5	UTSW	12	98830973	missense	probably damaging	1.00
R1183:Eml5	UTSW	12	98792046	missense	probably benign	0.31
R1352:Eml5	UTSW	12	98831003	splice site	probably benign
R1469:Eml5	UTSW	12	98858823	missense	probably benign
R1469:Eml5	UTSW	12	98858823	missense	probably benign
R1503:Eml5	UTSW	12	98831174	missense	probably damaging	0.99
R1538:Eml5	UTSW	12	98794276	missense	probably damaging	0.99
R1689:Eml5	UTSW	12	98830935	missense	probably damaging	1.00
R1773:Eml5	UTSW	12	98798839	missense	probably damaging	1.00
R1775:Eml5	UTSW	12	98852704	splice site	probably null
R1791:Eml5	UTSW	12	98887056	missense	probably benign	0.31
R1856:Eml5	UTSW	12	98810584	missense	probably damaging	1.00
R1919:Eml5	UTSW	12	98798839	missense	probably damaging	1.00
R1957:Eml5	UTSW	12	98859961	missense	probably damaging	1.00
R1962:Eml5	UTSW	12	98876311	missense	probably damaging	0.99
R2033:Eml5	UTSW	12	98791386	missense	possibly damaging	0.71
R2035:Eml5	UTSW	12	98794266	missense	probably benign	0.33
R2073:Eml5	UTSW	12	98802446	missense	probably damaging	0.99
R2143:Eml5	UTSW	12	98810605	missense	probably damaging	1.00
R2144:Eml5	UTSW	12	98810605	missense	probably damaging	1.00
R2158:Eml5	UTSW	12	98843946	splice site	probably benign
R2164:Eml5	UTSW	12	98887097	missense	probably damaging	0.99
R2175:Eml5	UTSW	12	98876223	nonsense	probably null
R2200:Eml5	UTSW	12	98825417	missense	probably damaging	1.00
R2234:Eml5	UTSW	12	98841581	missense	probably damaging	1.00
R2504:Eml5	UTSW	12	98844105	missense	possibly damaging	0.71
R2871:Eml5	UTSW	12	98865401	missense	probably damaging	1.00
R2871:Eml5	UTSW	12	98865401	missense	probably damaging	1.00
R2958:Eml5	UTSW	12	98876178	missense	possibly damaging	0.74
R3013:Eml5	UTSW	12	98880808	splice site	probably null
R3118:Eml5	UTSW	12	98865494	missense	probably damaging	0.97
R3735:Eml5	UTSW	12	98855989	missense	possibly damaging	0.78
R3856:Eml5	UTSW	12	98816024	missense	probably damaging	1.00
R3900:Eml5	UTSW	12	98825523	missense	probably damaging	1.00
R3973:Eml5	UTSW	12	98802465	splice site	probably benign
R3976:Eml5	UTSW	12	98802465	splice site	probably benign
R4105:Eml5	UTSW	12	98841548	splice site	probably null
R4107:Eml5	UTSW	12	98841548	splice site	probably null
R4108:Eml5	UTSW	12	98841548	splice site	probably null
R4109:Eml5	UTSW	12	98841548	splice site	probably null
R4258:Eml5	UTSW	12	98865434	missense	probably benign	0.01
R4381:Eml5	UTSW	12	98815955	missense	possibly damaging	0.93
R4590:Eml5	UTSW	12	98837341	missense	possibly damaging	0.91
R4737:Eml5	UTSW	12	98798852	missense	probably damaging	1.00
R4775:Eml5	UTSW	12	98802307	missense	probably benign	0.05
R4850:Eml5	UTSW	12	98790619	missense	probably damaging	1.00
R5007:Eml5	UTSW	12	98830965	missense	probably damaging	1.00
R5092:Eml5	UTSW	12	98792616	missense	probably damaging	1.00
R5123:Eml5	UTSW	12	98874512	missense	probably damaging	1.00
R5124:Eml5	UTSW	12	98792042	missense	probably damaging	1.00
R5273:Eml5	UTSW	12	98790688	missense	probably damaging	1.00
R5369:Eml5	UTSW	12	98858783	missense	probably damaging	1.00
R5430:Eml5	UTSW	12	98794158	missense	probably damaging	1.00
R5748:Eml5	UTSW	12	98825555	missense	probably damaging	0.99
R5769:Eml5	UTSW	12	98790619	missense	probably damaging	1.00
R5832:Eml5	UTSW	12	98876188	missense	probably benign
R6113:Eml5	UTSW	12	98824674	nonsense	probably null
R6131:Eml5	UTSW	12	98861251	missense	probably damaging	0.99
R6175:Eml5	UTSW	12	98794456	missense	possibly damaging	0.69
R6184:Eml5	UTSW	12	98863129	missense	possibly damaging	0.53
R6357:Eml5	UTSW	12	98870884	missense	probably damaging	0.98
R6375:Eml5	UTSW	12	98798868
R6528:Eml5	UTSW	12	98824637	missense	probably benign	0.18
R6657:Eml5	UTSW	12	98791405	missense	probably damaging	0.98
R6717:Eml5	UTSW	12	98827506	missense	probably damaging	1.00
R6751:Eml5	UTSW	12	98865400	missense	probably damaging	1.00
R6833:Eml5	UTSW	12	98887024	missense	probably damaging	1.00
R6834:Eml5	UTSW	12	98887024	missense	probably damaging	1.00
R6972:Eml5	UTSW	12	98876180	missense	probably benign	0.00
R7091:Eml5	UTSW	12	98802474	missense	probably benign	0.16
R7353:Eml5	UTSW	12	98825424	missense
R7644:Eml5	UTSW	12	98855944	missense	probably benign	0.05
R7694:Eml5	UTSW	12	98792563	missense	probably damaging	0.99
R7842:Eml5	UTSW	12	98794135	missense	probably damaging	1.00
R7933:Eml5	UTSW	12	98844020	missense	possibly damaging	0.87
R8111:Eml5	UTSW	12	98792514	critical splice donor site	probably null
R8198:Eml5	UTSW	12	98858886	nonsense	probably null
R8482:Eml5	UTSW	12	98876301	missense	probably damaging	1.00
R8732:Eml5	UTSW	12	98815959	missense	probably damaging	0.99
R8956:Eml5	UTSW	12	98852693	missense	possibly damaging	0.69
R8975:Eml5	UTSW	12	98810570	missense	probably damaging	0.99
R9131:Eml5	UTSW	12	98858840	missense	probably damaging	1.00
R9258:Eml5	UTSW	12	98844117	missense	possibly damaging	0.77
R9261:Eml5	UTSW	12	98856028	missense	probably damaging	0.99
R9276:Eml5	UTSW	12	98798801	missense	probably damaging	0.99
R9301:Eml5	UTSW	12	98882033	nonsense	probably null
R9368:Eml5	UTSW	12	98796578	missense	probably benign	0.31
R9392:Eml5	UTSW	12	98900940	missense	probably damaging	1.00
R9393:Eml5	UTSW	12	98876174	missense	probably benign	0.35
R9449:Eml5	UTSW	12	98861295	missense	probably damaging	1.00
T0722:Eml5	UTSW	12	98841582	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- TCATATTTAGGGATTTGGAAGGAGA -3'
(R):5'- ACTGTTCTTTGTAACTGTGGACATT -3'

Sequencing Primer
(F):5'- AGAGAACAAAACAGACCATGATTG -3'
(R):5'- CTGTGGACATTTTGAAAGCAGTAC -3'

Posted On

2020-08-01