Mutagenetix > Incidental Mutations

Incidental Mutation 'BB010:Dnah12'

642598

Institutional Source

Beutler Lab

Gene Symbol

Dnah12

Ensembl Gene

ENSMUSG00000021879

Gene Name

dynein, axonemal, heavy chain 12

Synonyms

DHC3, Hdhc3, HL-19, Dnahc7l, 4921531P07Rik, LOC380889, DLP12, HL19, Dnahc12

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.178) question?

Stock #

BB010

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

26693274-26891703 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 26766115 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Leucine at position 992 (Q992L)

Ref Sequence

ENSEMBL: ENSMUSP00000022433 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022433] [ENSMUST00000073309]

Predicted Effect

probably benign
Transcript: ENSMUST00000022433
AA Change: Q992L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000022433
Gene: ENSMUSG00000021879
AA Change: Q992L

Domain	Start	End	E-Value	Type
low complexity region	127	140	N/A	INTRINSIC
coiled coil region	588	666	N/A	INTRINSIC
Pfam:DHC_N2	676	1113	1.1e-147	PFAM
AAA	1268	1407	1.15e0	SMART
Pfam:AAA_5	1552	1695	1.5e-7	PFAM
Blast:AAA	1709	1827	2e-24	BLAST
Blast:AAA	1848	1898	1e-16	BLAST
AAA	1903	2051	5.42e-4	SMART
Pfam:AAA_8	2238	2316	2e-18	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000073309

SMART Domains

Protein: ENSMUSP00000073035
Gene: ENSMUSG00000021879

Domain	Start	End	E-Value	Type
Pfam:AAA_6	1	203	4e-84	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	A	G	13: 59,743,751	L85P	probably damaging	Het
4933414I15Rik	A	G	11: 50,942,400	V125A	unknown	Het
Adam34	T	A	8: 43,650,874	H578L	probably damaging	Het
Ago4	A	T	4: 126,507,018	M678K	probably benign	Het
Atrn	T	C	2: 130,995,066	L1150P	probably damaging	Het
Camta1	C	T	4: 151,083,757	E279K	probably damaging	Het
Ccdc88c	T	C	12: 100,945,490	D695G	possibly damaging	Het
Col11a2	A	T	17: 34,056,055	K400*	probably null	Het
Cpsf4	T	A	5: 145,167,358	M1K	probably null	Het
Dnajc7	T	C	11: 100,596,212	Y145C	probably damaging	Het
Eml5	A	T	12: 98,844,020	D892E	possibly damaging	Het
Fam193a	A	G	5: 34,466,195	K23E	possibly damaging	Het
Fam214b	A	T	4: 43,035,919	C271S	probably benign	Het
Filip1	T	G	9: 79,820,047	K430T	possibly damaging	Het
Gm5089	T	C	14: 122,435,991	D106G	unknown	Het
Hip1	A	T	5: 135,460,456	N45K	probably damaging	Het
Hivep2	T	C	10: 14,127,837	S60P	probably damaging	Het
Ighv1-53	A	T	12: 115,158,409	C115*	probably null	Het
Macf1	T	C	4: 123,409,651	T353A	probably benign	Het
Mast3	A	T	8: 70,786,635	V433E	probably damaging	Het
Mast4	A	T	13: 102,772,563	M660K	probably damaging	Het
Nr2e1	T	C	10: 42,563,383	Y380C	probably damaging	Het
Olfr1465	T	A	19: 13,314,205	M27L	probably benign	Het
Olfr980	T	C	9: 40,007,135		probably benign	Het
Otog	A	G	7: 46,310,147	D720G	probably damaging	Het
Slc6a1	T	A	6: 114,311,898	W473R	probably damaging	Het
Smpd3	A	C	8: 106,255,622	C617G	probably benign	Het
Sprr3	T	C	3: 92,457,208	I110V	possibly damaging	Het
Ston1	A	G	17: 88,636,144	E326G	probably benign	Het
Tapbpl	T	G	6: 125,230,270	Q152P	probably damaging	Het
Tectb	C	T	19: 55,194,673	L319F	possibly damaging	Het
Tpp2	G	A	1: 43,960,961	G413D	probably damaging	Het
Tpsg1	A	G	17: 25,373,204	H84R	probably damaging	Het
Usp24	A	G	4: 106,428,489	N2437S	probably benign	Het
Usp32	T	C	11: 85,007,059	Q1152R	probably damaging	Het
Vmn2r6	T	C	3: 64,559,803	T92A	probably benign	Het
Xpo7	A	G	14: 70,707,348	V35A	probably benign	Het
Zan	T	A	5: 137,463,579	T1113S	unknown	Het
Zfp169	A	G	13: 48,490,481	V390A	unknown	Het

Other mutations in Dnah12

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01412:Dnah12	APN	14	26771005	missense	probably damaging	1.00
IGL01602:Dnah12	APN	14	26710275	splice site	probably benign
IGL01681:Dnah12	APN	14	26722160	missense	probably benign
IGL02082:Dnah12	APN	14	26707162	missense	possibly damaging	0.79
IGL02140:Dnah12	APN	14	26716577	missense	probably benign	0.20
IGL02170:Dnah12	APN	14	26773112	missense	probably damaging	0.99
IGL02174:Dnah12	APN	14	26706917	missense	probably benign	0.00
IGL02367:Dnah12	APN	14	26709161	missense	probably benign	0.30
IGL02418:Dnah12	APN	14	26773722	missense	probably damaging	1.00
IGL03039:Dnah12	APN	14	26724512	missense	probably benign	0.02
IGL03066:Dnah12	APN	14	26697398	missense	probably benign	0.06
drippings	UTSW	14	26854804	missense	probably damaging	1.00
grueben	UTSW	14	26878079	missense	probably damaging	1.00
BB020:Dnah12	UTSW	14	26766115	missense	probably benign	0.00
F5770:Dnah12	UTSW	14	26773093	missense	possibly damaging	0.95
FR4304:Dnah12	UTSW	14	26849385	missense	probably damaging	1.00
FR4340:Dnah12	UTSW	14	26849385	missense	probably damaging	1.00
FR4342:Dnah12	UTSW	14	26849385	missense	probably damaging	1.00
FR4589:Dnah12	UTSW	14	26849385	missense	probably damaging	1.00
IGL03055:Dnah12	UTSW	14	26872740	missense	probably damaging	1.00
LCD18:Dnah12	UTSW	14	26849385	missense	probably damaging	1.00
R0003:Dnah12	UTSW	14	26772644	missense	probably damaging	1.00
R0110:Dnah12	UTSW	14	26798899	missense	probably damaging	1.00
R0302:Dnah12	UTSW	14	26799999	missense	probably damaging	1.00
R0355:Dnah12	UTSW	14	26706117	splice site	probably null
R0364:Dnah12	UTSW	14	26724473	missense	probably benign	0.10
R0469:Dnah12	UTSW	14	26798899	missense	probably damaging	1.00
R0558:Dnah12	UTSW	14	26709310	missense	probably benign	0.00
R0709:Dnah12	UTSW	14	26884265	splice site	probably benign
R0734:Dnah12	UTSW	14	26800013	missense	probably benign	0.00
R1273:Dnah12	UTSW	14	26739220	nonsense	probably null
R1496:Dnah12	UTSW	14	26710248	missense	probably benign
R1503:Dnah12	UTSW	14	26773692	missense	probably damaging	1.00
R1535:Dnah12	UTSW	14	26816322	missense	possibly damaging	0.91
R1608:Dnah12	UTSW	14	26766190	missense	probably damaging	1.00
R1682:Dnah12	UTSW	14	26778883	missense	possibly damaging	0.71
R1758:Dnah12	UTSW	14	26766114	missense	probably benign	0.02
R1826:Dnah12	UTSW	14	26711019	missense	probably benign	0.01
R1829:Dnah12	UTSW	14	26773023	missense	probably damaging	1.00
R1829:Dnah12	UTSW	14	26800075	missense	probably damaging	1.00
R1862:Dnah12	UTSW	14	26697398	missense	probably benign	0.06
R1862:Dnah12	UTSW	14	26709257	missense	probably benign	0.30
R1913:Dnah12	UTSW	14	26792264	splice site	probably null
R1933:Dnah12	UTSW	14	26734495	missense	probably damaging	0.98
R2006:Dnah12	UTSW	14	26814459	missense	possibly damaging	0.95
R2045:Dnah12	UTSW	14	26781528	missense	probably null	1.00
R2113:Dnah12	UTSW	14	26766141	missense	probably damaging	1.00
R2125:Dnah12	UTSW	14	26724458	nonsense	probably null
R2126:Dnah12	UTSW	14	26724458	nonsense	probably null
R2207:Dnah12	UTSW	14	26781787	missense	probably damaging	0.99
R2213:Dnah12	UTSW	14	26739330	missense	probably benign	0.06
R2511:Dnah12	UTSW	14	26769950	missense	possibly damaging	0.65
R2875:Dnah12	UTSW	14	26693470	missense	probably benign	0.04
R2875:Dnah12	UTSW	14	26876950	missense	probably benign	0.05
R3551:Dnah12	UTSW	14	26770972	missense	probably benign	0.01
R3713:Dnah12	UTSW	14	26812790	missense	probably benign
R3729:Dnah12	UTSW	14	26706065	missense	probably benign	0.02
R3799:Dnah12	UTSW	14	26770923	missense	probably damaging	1.00
R3846:Dnah12	UTSW	14	26710211	missense	probably benign	0.00
R3892:Dnah12	UTSW	14	26856616	missense	probably benign	0.03
R3921:Dnah12	UTSW	14	26771051	missense	probably damaging	1.00
R3940:Dnah12	UTSW	14	26723599	missense	probably benign
R4065:Dnah12	UTSW	14	26770448	missense	probably benign	0.02
R4113:Dnah12	UTSW	14	26693567	missense	probably damaging	0.98
R4249:Dnah12	UTSW	14	26709186	missense	possibly damaging	0.70
R4259:Dnah12	UTSW	14	26798926	missense	probably benign	0.01
R4260:Dnah12	UTSW	14	26798926	missense	probably benign	0.01
R4348:Dnah12	UTSW	14	26814541	missense	possibly damaging	0.94
R4457:Dnah12	UTSW	14	26815507	missense	probably damaging	1.00
R4490:Dnah12	UTSW	14	26734603	missense	possibly damaging	0.67
R4491:Dnah12	UTSW	14	26734603	missense	possibly damaging	0.67
R4494:Dnah12	UTSW	14	26871855	missense	probably damaging	0.99
R4523:Dnah12	UTSW	14	26770022	missense	probably damaging	0.97
R4523:Dnah12	UTSW	14	26876958	missense	possibly damaging	0.83
R4546:Dnah12	UTSW	14	26773014	missense	probably damaging	1.00
R4584:Dnah12	UTSW	14	26772594	missense	probably damaging	1.00
R4624:Dnah12	UTSW	14	26735758	missense	possibly damaging	0.82
R4689:Dnah12	UTSW	14	26706839	missense	probably benign	0.00
R4727:Dnah12	UTSW	14	26872317	missense	probably damaging	1.00
R4732:Dnah12	UTSW	14	26781784	missense	probably damaging	1.00
R4733:Dnah12	UTSW	14	26781784	missense	probably damaging	1.00
R4851:Dnah12	UTSW	14	26716629	nonsense	probably null
R4879:Dnah12	UTSW	14	26718046	critical splice donor site	probably null
R4893:Dnah12	UTSW	14	26710170	missense	possibly damaging	0.66
R4915:Dnah12	UTSW	14	26734570	missense	probably damaging	1.00
R4927:Dnah12	UTSW	14	26861805	nonsense	probably null
R4939:Dnah12	UTSW	14	26891524	missense	probably damaging	1.00
R4962:Dnah12	UTSW	14	26716700	missense	probably benign	0.00
R5011:Dnah12	UTSW	14	26710171	missense	probably benign	0.03
R5013:Dnah12	UTSW	14	26710171	missense	probably benign	0.03
R5043:Dnah12	UTSW	14	26884190	missense	probably damaging	1.00
R5049:Dnah12	UTSW	14	26735697	missense	probably benign	0.09
R5122:Dnah12	UTSW	14	26718000	missense	probably benign	0.00
R5135:Dnah12	UTSW	14	26770477	missense	probably damaging	0.99
R5149:Dnah12	UTSW	14	26850926	nonsense	probably null
R5154:Dnah12	UTSW	14	26849363	missense	probably benign	0.12
R5206:Dnah12	UTSW	14	26769985	missense	probably damaging	1.00
R5307:Dnah12	UTSW	14	26693486	missense	possibly damaging	0.49
R5330:Dnah12	UTSW	14	26773830	missense	probably damaging	1.00
R5335:Dnah12	UTSW	14	26879738	missense	probably damaging	1.00
R5339:Dnah12	UTSW	14	26814537	missense	possibly damaging	0.83
R5354:Dnah12	UTSW	14	26774342	splice site	probably null
R5389:Dnah12	UTSW	14	26735749	missense	probably damaging	1.00
R5434:Dnah12	UTSW	14	26859299	missense	probably damaging	1.00
R5466:Dnah12	UTSW	14	26771050	missense	probably damaging	1.00
R5655:Dnah12	UTSW	14	26710269	missense	probably benign	0.01
R5681:Dnah12	UTSW	14	26815495	missense	probably benign	0.32
R5824:Dnah12	UTSW	14	26770518	critical splice donor site	probably null
R5863:Dnah12	UTSW	14	26854921	missense	probably damaging	1.00
R5890:Dnah12	UTSW	14	26706884	missense	probably benign	0.09
R5912:Dnah12	UTSW	14	26770008	nonsense	probably null
R5916:Dnah12	UTSW	14	26706918	missense	possibly damaging	0.92
R5941:Dnah12	UTSW	14	26706867	missense	probably benign	0.00
R5987:Dnah12	UTSW	14	26886871	missense	possibly damaging	0.54
R5992:Dnah12	UTSW	14	26697341	missense	probably benign	0.04
R6132:Dnah12	UTSW	14	26717911	missense	probably damaging	1.00
R6136:Dnah12	UTSW	14	26875270	missense	probably damaging	0.99
R6158:Dnah12	UTSW	14	26773685	missense	possibly damaging	0.95
R6183:Dnah12	UTSW	14	26861769	missense	probably damaging	1.00
R6191:Dnah12	UTSW	14	26710257	missense	probably benign	0.03
R6235:Dnah12	UTSW	14	26854804	missense	probably damaging	1.00
R6277:Dnah12	UTSW	14	26770482	missense	probably damaging	1.00
R6332:Dnah12	UTSW	14	26717974	missense	probably damaging	0.99
R6334:Dnah12	UTSW	14	26706834	missense	possibly damaging	0.51
R6443:Dnah12	UTSW	14	26878051	missense	probably benign	0.06
R6480:Dnah12	UTSW	14	26872455	missense	probably damaging	1.00
R6530:Dnah12	UTSW	14	26735710	missense	probably damaging	1.00
R6678:Dnah12	UTSW	14	26735692	missense	probably damaging	1.00
R6709:Dnah12	UTSW	14	26872749	missense	probably damaging	1.00
R6724:Dnah12	UTSW	14	26796223	missense	probably benign	0.02
R6745:Dnah12	UTSW	14	26707228	missense	probably damaging	0.99
R6788:Dnah12	UTSW	14	26801513	missense	probably damaging	0.99
R6894:Dnah12	UTSW	14	26735749	missense	probably damaging	1.00
R6912:Dnah12	UTSW	14	26878079	missense	probably damaging	1.00
R6982:Dnah12	UTSW	14	26799076	splice site	probably null
R7001:Dnah12	UTSW	14	26879724	missense	probably damaging	0.99
R7002:Dnah12	UTSW	14	26876998	missense	probably damaging	1.00
R7017:Dnah12	UTSW	14	26735680	missense	probably benign
R7107:Dnah12	UTSW	14	26778912	critical splice donor site	probably null
R7108:Dnah12	UTSW	14	26778912	critical splice donor site	probably null
R7121:Dnah12	UTSW	14	26778912	critical splice donor site	probably null
R7122:Dnah12	UTSW	14	26778912	critical splice donor site	probably null
R7135:Dnah12	UTSW	14	26778912	critical splice donor site	probably null
R7135:Dnah12	UTSW	14	26801413	missense	probably damaging	0.99
R7150:Dnah12	UTSW	14	26861732	missense	probably damaging	0.99
R7188:Dnah12	UTSW	14	26814413	missense	probably benign	0.04
R7201:Dnah12	UTSW	14	26814622	missense	probably benign	0.08
R7202:Dnah12	UTSW	14	26778912	critical splice donor site	probably null
R7204:Dnah12	UTSW	14	26778912	critical splice donor site	probably null
R7204:Dnah12	UTSW	14	26781485	missense	probably damaging	0.99
R7205:Dnah12	UTSW	14	26778912	critical splice donor site	probably null
R7206:Dnah12	UTSW	14	26778912	critical splice donor site	probably null
R7219:Dnah12	UTSW	14	26854880	missense	probably damaging	0.99
R7337:Dnah12	UTSW	14	26766577	splice site	probably null
R7339:Dnah12	UTSW	14	26872320	missense	probably benign
R7363:Dnah12	UTSW	14	26724611	missense	probably benign
R7426:Dnah12	UTSW	14	26724626	missense	probably benign	0.01
R7472:Dnah12	UTSW	14	26856635	missense	probably benign	0.01
R7579:Dnah12	UTSW	14	26770503	missense	probably benign	0.05
R7655:Dnah12	UTSW	14	26859316	missense	probably benign	0.21
R7656:Dnah12	UTSW	14	26859316	missense	probably benign	0.21
R7694:Dnah12	UTSW	14	26781380	missense	probably damaging	1.00
R7730:Dnah12	UTSW	14	26785933	missense	probably damaging	1.00
R7837:Dnah12	UTSW	14	26796219	missense	probably benign	0.01
R7855:Dnah12	UTSW	14	26829329	missense	probably benign	0.14
R7870:Dnah12	UTSW	14	26856529	missense	probably benign	0.00
R7920:Dnah12	UTSW	14	26856542	missense	possibly damaging	0.58
R7933:Dnah12	UTSW	14	26766115	missense	probably benign	0.00
R7956:Dnah12	UTSW	14	26709272	missense	probably damaging	0.96
R8192:Dnah12	UTSW	14	26706881	missense	probably benign
R8263:Dnah12	UTSW	14	26891464	missense	noncoding transcript
R8287:Dnah12	UTSW	14	26812603	missense	probably benign
R8336:Dnah12	UTSW	14	26711065	missense	probably benign	0.01
R8362:Dnah12	UTSW	14	26854831	missense	probably damaging	1.00
R8392:Dnah12	UTSW	14	26885912	missense	probably benign
R8458:Dnah12	UTSW	14	26826892	critical splice acceptor site	probably null
R8481:Dnah12	UTSW	14	26853796	missense	probably benign	0.02
R8551:Dnah12	UTSW	14	26774270	missense	probably damaging	0.97
R8669:Dnah12	UTSW	14	26830625	splice site	probably benign
R8698:Dnah12	UTSW	14	26707263	missense	probably benign	0.02
R8709:Dnah12	UTSW	14	26693602	missense	probably benign	0.00
R8778:Dnah12	UTSW	14	26734563	missense	probably benign	0.29
V7580:Dnah12	UTSW	14	26773093	missense	possibly damaging	0.95
V7581:Dnah12	UTSW	14	26773093	missense	possibly damaging	0.95
X0018:Dnah12	UTSW	14	26814480	missense	probably damaging	1.00
X0027:Dnah12	UTSW	14	26816288	missense	probably damaging	1.00
X0065:Dnah12	UTSW	14	26814645	missense	possibly damaging	0.93
Z1177:Dnah12	UTSW	14	26875215	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGAAGGGGAGGGTATATTTCACTAC -3'
(R):5'- GGATCTTTGGTCTCTGACAAAATCTC -3'

Sequencing Primer
(F):5'- GGAGGGTATATTTCACTACTGATTTC -3'
(R):5'- GTCTCTGACAAAATCTCTAGCATTTC -3'

Posted On

2020-08-01