Incidental Mutation 'BB010:Col11a2'
ID642602
Institutional Source Beutler Lab
Gene Symbol Col11a2
Ensembl Gene ENSMUSG00000024330
Gene Namecollagen, type XI, alpha 2
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.932) question?
Stock #BB010
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location34039437-34066685 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 34056055 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 400 (K400*)
Ref Sequence ENSEMBL: ENSMUSP00000115026 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087497] [ENSMUST00000114252] [ENSMUST00000114255] [ENSMUST00000131134] [ENSMUST00000143354]
Predicted Effect probably null
Transcript: ENSMUST00000087497
AA Change: K708*
SMART Domains Protein: ENSMUSP00000084772
Gene: ENSMUSG00000024330
AA Change: K708*

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
TSPN 31 214 4.25e-72 SMART
LamG 82 213 1.08e-9 SMART
Pfam:Collagen 306 364 2.2e-9 PFAM
Pfam:Collagen 399 460 1e-10 PFAM
Pfam:Collagen 437 520 1.2e-7 PFAM
Pfam:Collagen 479 553 5.7e-9 PFAM
Pfam:Collagen 506 579 1.6e-8 PFAM
internal_repeat_4 584 614 3.98e-5 PROSPERO
internal_repeat_2 584 669 5.49e-20 PROSPERO
internal_repeat_1 587 740 2.58e-22 PROSPERO
Pfam:Collagen 743 814 1.5e-8 PFAM
Pfam:Collagen 767 839 4.8e-7 PFAM
low complexity region 854 872 N/A INTRINSIC
Pfam:Collagen 881 946 4.5e-8 PFAM
Pfam:Collagen 905 976 2e-7 PFAM
Pfam:Collagen 933 1002 2.7e-8 PFAM
low complexity region 1013 1047 N/A INTRINSIC
low complexity region 1064 1112 N/A INTRINSIC
low complexity region 1121 1199 N/A INTRINSIC
low complexity region 1216 1232 N/A INTRINSIC
low complexity region 1289 1320 N/A INTRINSIC
Pfam:Collagen 1358 1417 1.7e-8 PFAM
COLFI 1454 1649 4.42e-117 SMART
Predicted Effect probably null
Transcript: ENSMUST00000114252
AA Change: K713*
SMART Domains Protein: ENSMUSP00000109890
Gene: ENSMUSG00000024330
AA Change: K713*

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
TSPN 31 214 4.25e-72 SMART
LamG 82 213 1.08e-9 SMART
Pfam:Collagen 311 369 2.3e-9 PFAM
Pfam:Collagen 404 465 1.1e-10 PFAM
Pfam:Collagen 442 525 1.3e-7 PFAM
Pfam:Collagen 484 558 6.4e-9 PFAM
Pfam:Collagen 511 584 1.7e-8 PFAM
internal_repeat_4 589 619 3.69e-5 PROSPERO
internal_repeat_2 589 674 4.46e-20 PROSPERO
internal_repeat_1 592 745 2.05e-22 PROSPERO
internal_repeat_3 636 752 7.84e-10 PROSPERO
Pfam:Collagen 772 844 5.5e-7 PFAM
Pfam:Collagen 800 869 1.9e-8 PFAM
Pfam:Collagen 886 951 5e-8 PFAM
Pfam:Collagen 910 981 2.2e-7 PFAM
Pfam:Collagen 934 1007 6.9e-7 PFAM
low complexity region 1018 1052 N/A INTRINSIC
low complexity region 1069 1117 N/A INTRINSIC
low complexity region 1126 1204 N/A INTRINSIC
low complexity region 1221 1237 N/A INTRINSIC
low complexity region 1294 1325 N/A INTRINSIC
Pfam:Collagen 1363 1422 1.9e-8 PFAM
COLFI 1459 1654 4.42e-117 SMART
Predicted Effect probably null
Transcript: ENSMUST00000114255
AA Change: K747*
SMART Domains Protein: ENSMUSP00000109893
Gene: ENSMUSG00000024330
AA Change: K747*

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
TSPN 31 214 4.25e-72 SMART
LamG 82 213 1.08e-9 SMART
low complexity region 257 268 N/A INTRINSIC
low complexity region 295 307 N/A INTRINSIC
Pfam:Collagen 345 403 2.1e-9 PFAM
Pfam:Collagen 438 499 1.1e-10 PFAM
Pfam:Collagen 521 593 2.2e-8 PFAM
Pfam:Collagen 545 613 9.1e-10 PFAM
internal_repeat_4 623 653 2.83e-5 PROSPERO
internal_repeat_2 623 708 2.11e-20 PROSPERO
internal_repeat_1 626 779 9e-23 PROSPERO
internal_repeat_3 670 786 5.16e-10 PROSPERO
low complexity region 788 819 N/A INTRINSIC
low complexity region 830 857 N/A INTRINSIC
low complexity region 866 887 N/A INTRINSIC
low complexity region 893 911 N/A INTRINSIC
low complexity region 919 935 N/A INTRINSIC
Pfam:Collagen 973 1041 2.9e-8 PFAM
low complexity region 1052 1086 N/A INTRINSIC
low complexity region 1103 1151 N/A INTRINSIC
low complexity region 1160 1238 N/A INTRINSIC
low complexity region 1255 1271 N/A INTRINSIC
low complexity region 1328 1359 N/A INTRINSIC
Pfam:Collagen 1394 1456 1.5e-8 PFAM
COLFI 1493 1688 4.42e-117 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131134
SMART Domains Protein: ENSMUSP00000122082
Gene: ENSMUSG00000024330

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
TSPN 31 214 4.25e-72 SMART
LamG 82 213 1.08e-9 SMART
low complexity region 303 314 N/A INTRINSIC
low complexity region 342 354 N/A INTRINSIC
Pfam:Collagen 392 450 7.8e-10 PFAM
Pfam:Collagen 484 543 1.4e-10 PFAM
Pfam:Collagen 514 581 9.5e-11 PFAM
Pfam:Collagen 565 624 2.1e-11 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000143354
AA Change: K400*
SMART Domains Protein: ENSMUSP00000115026
Gene: ENSMUSG00000024330
AA Change: K400*

DomainStartEndE-ValueType
Pfam:Collagen 3 56 4.7e-9 PFAM
Pfam:Collagen 91 152 1.7e-9 PFAM
internal_repeat_1 158 301 3.7e-11 PROSPERO
internal_repeat_2 276 321 1.18e-9 PROSPERO
internal_repeat_4 291 306 1.06e-5 PROSPERO
internal_repeat_3 303 353 1.87e-6 PROSPERO
internal_repeat_2 315 360 1.18e-9 PROSPERO
internal_repeat_1 323 439 3.7e-11 PROSPERO
low complexity region 441 472 N/A INTRINSIC
low complexity region 483 510 N/A INTRINSIC
low complexity region 519 540 N/A INTRINSIC
low complexity region 546 564 N/A INTRINSIC
low complexity region 572 588 N/A INTRINSIC
Pfam:Collagen 603 673 6.6e-6 PFAM
Pfam:Collagen 627 694 5.4e-7 PFAM
Pfam:Collagen 660 734 3.2e-7 PFAM
Pfam:Collagen 711 770 1.1e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes the alpha-2 subunit of type XI collagen, one of the low abundance fibrillar collagens found in cartilage. The encoded protein, in association with other collagen subunits, forms a heterotrimeric type XI procollagen that may undergo proteolytic processing similar to the alpha-1 subunit. Mice lacking the encoded protein exhibit a mild phenotype similar to nonocular Stickler syndrome, otospondylomegaepiphyseal dysplasia (OSMED) as well as a nonsyndromic form of deafness called DFNA13. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous mutant animals exhibit reduced body size, short snout, a slightly bulged forehead, deafness, and disorganization of chondrocytes in the growth plate of long bones. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A G 13: 59,743,751 L85P probably damaging Het
4933414I15Rik A G 11: 50,942,400 V125A unknown Het
Adam34 T A 8: 43,650,874 H578L probably damaging Het
Ago4 A T 4: 126,507,018 M678K probably benign Het
Atrn T C 2: 130,995,066 L1150P probably damaging Het
Camta1 C T 4: 151,083,757 E279K probably damaging Het
Ccdc88c T C 12: 100,945,490 D695G possibly damaging Het
Cpsf4 T A 5: 145,167,358 M1K probably null Het
Dnah12 A T 14: 26,766,115 Q992L probably benign Het
Dnajc7 T C 11: 100,596,212 Y145C probably damaging Het
Eml5 A T 12: 98,844,020 D892E possibly damaging Het
Fam193a A G 5: 34,466,195 K23E possibly damaging Het
Fam214b A T 4: 43,035,919 C271S probably benign Het
Filip1 T G 9: 79,820,047 K430T possibly damaging Het
Gm5089 T C 14: 122,435,991 D106G unknown Het
Hip1 A T 5: 135,460,456 N45K probably damaging Het
Hivep2 T C 10: 14,127,837 S60P probably damaging Het
Ighv1-53 A T 12: 115,158,409 C115* probably null Het
Macf1 T C 4: 123,409,651 T353A probably benign Het
Mast3 A T 8: 70,786,635 V433E probably damaging Het
Mast4 A T 13: 102,772,563 M660K probably damaging Het
Nr2e1 T C 10: 42,563,383 Y380C probably damaging Het
Olfr1465 T A 19: 13,314,205 M27L probably benign Het
Olfr980 T C 9: 40,007,135 probably benign Het
Otog A G 7: 46,310,147 D720G probably damaging Het
Slc6a1 T A 6: 114,311,898 W473R probably damaging Het
Smpd3 A C 8: 106,255,622 C617G probably benign Het
Sprr3 T C 3: 92,457,208 I110V possibly damaging Het
Ston1 A G 17: 88,636,144 E326G probably benign Het
Tapbpl T G 6: 125,230,270 Q152P probably damaging Het
Tectb C T 19: 55,194,673 L319F possibly damaging Het
Tpp2 G A 1: 43,960,961 G413D probably damaging Het
Tpsg1 A G 17: 25,373,204 H84R probably damaging Het
Usp24 A G 4: 106,428,489 N2437S probably benign Het
Usp32 T C 11: 85,007,059 Q1152R probably damaging Het
Vmn2r6 T C 3: 64,559,803 T92A probably benign Het
Xpo7 A G 14: 70,707,348 V35A probably benign Het
Zan T A 5: 137,463,579 T1113S unknown Het
Zfp169 A G 13: 48,490,481 V390A unknown Het
Other mutations in Col11a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01723:Col11a2 APN 17 34061280 unclassified probably benign
IGL01839:Col11a2 APN 17 34064082 unclassified probably benign
IGL02429:Col11a2 APN 17 34042292 missense probably damaging 1.00
IGL02491:Col11a2 APN 17 34064207 unclassified probably benign
BB020:Col11a2 UTSW 17 34056055 nonsense probably null
PIT4531001:Col11a2 UTSW 17 34046438 critical splice acceptor site probably null
R0001:Col11a2 UTSW 17 34061612 missense probably benign 0.00
R0005:Col11a2 UTSW 17 34062879 unclassified probably benign
R0099:Col11a2 UTSW 17 34049674 missense probably damaging 0.99
R0106:Col11a2 UTSW 17 34057275 missense probably damaging 0.99
R0243:Col11a2 UTSW 17 34062546 unclassified probably benign
R0254:Col11a2 UTSW 17 34064803 unclassified probably benign
R0352:Col11a2 UTSW 17 34042527 missense probably benign 0.43
R0362:Col11a2 UTSW 17 34062446 splice site probably null
R0491:Col11a2 UTSW 17 34042212 missense probably null 0.00
R0531:Col11a2 UTSW 17 34058377 splice site probably benign
R0538:Col11a2 UTSW 17 34051328 splice site probably benign
R0646:Col11a2 UTSW 17 34059348 critical splice donor site probably null
R0676:Col11a2 UTSW 17 34057275 missense probably damaging 0.99
R0919:Col11a2 UTSW 17 34059150 missense possibly damaging 0.93
R1522:Col11a2 UTSW 17 34055254 missense probably damaging 1.00
R1767:Col11a2 UTSW 17 34063895 unclassified probably benign
R1872:Col11a2 UTSW 17 34062555 unclassified probably benign
R1941:Col11a2 UTSW 17 34044951 missense probably benign 0.01
R1945:Col11a2 UTSW 17 34059168 missense probably damaging 1.00
R2101:Col11a2 UTSW 17 34052169 missense probably damaging 1.00
R2161:Col11a2 UTSW 17 34064797 unclassified probably benign
R2258:Col11a2 UTSW 17 34039677 missense probably benign
R2259:Col11a2 UTSW 17 34039677 missense probably benign
R2260:Col11a2 UTSW 17 34039677 missense probably benign
R2761:Col11a2 UTSW 17 34051026 missense probably damaging 1.00
R3114:Col11a2 UTSW 17 34046468 missense possibly damaging 0.69
R3824:Col11a2 UTSW 17 34054180 missense probably damaging 1.00
R3938:Col11a2 UTSW 17 34039625 unclassified probably benign
R4039:Col11a2 UTSW 17 34045774 missense probably benign 0.00
R4675:Col11a2 UTSW 17 34064293 critical splice donor site probably null
R4810:Col11a2 UTSW 17 34057112 missense probably damaging 0.99
R4824:Col11a2 UTSW 17 34050963 missense probably damaging 1.00
R4944:Col11a2 UTSW 17 34042190 missense possibly damaging 0.47
R5112:Col11a2 UTSW 17 34064088 unclassified probably benign
R5355:Col11a2 UTSW 17 34051801 missense probably benign 0.07
R5384:Col11a2 UTSW 17 34059174 critical splice donor site probably null
R5534:Col11a2 UTSW 17 34051024 missense probably damaging 0.99
R5860:Col11a2 UTSW 17 34064185 unclassified probably benign
R6252:Col11a2 UTSW 17 34042212 missense probably null 0.00
R6327:Col11a2 UTSW 17 34043317 missense probably benign 0.32
R6828:Col11a2 UTSW 17 34053633 splice site probably null
R6860:Col11a2 UTSW 17 34053598 missense probably damaging 1.00
R6873:Col11a2 UTSW 17 34065019 missense unknown
R6992:Col11a2 UTSW 17 34047144 missense probably benign 0.01
R7292:Col11a2 UTSW 17 34051508 missense unknown
R7543:Col11a2 UTSW 17 34050456 missense unknown
R7933:Col11a2 UTSW 17 34056055 nonsense probably null
R8157:Col11a2 UTSW 17 34061256 missense unknown
R8161:Col11a2 UTSW 17 34051290 missense unknown
R8209:Col11a2 UTSW 17 34047279 critical splice donor site probably null
R8493:Col11a2 UTSW 17 34059962 missense possibly damaging 0.82
R8705:Col11a2 UTSW 17 34049795 missense unknown
R8901:Col11a2 UTSW 17 34043280 missense probably damaging 1.00
R8946:Col11a2 UTSW 17 34051783 missense probably benign 0.40
X0017:Col11a2 UTSW 17 34059985 critical splice donor site probably null
X0064:Col11a2 UTSW 17 34042247 missense possibly damaging 0.88
Z1176:Col11a2 UTSW 17 34056402 missense unknown
Z1177:Col11a2 UTSW 17 34051666 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- TGTTTCCTACGACAGCGCTG -3'
(R):5'- TTAGGAAGAGCCCTACCACC -3'

Sequencing Primer
(F):5'- TACGACAGCGCTGCATCCTC -3'
(R):5'- ACCACCCACAGGCCTCTATTTC -3'
Posted On2020-08-01