Mutagenetix > Incidental Mutation

Incidental Mutation 'BB010:Ston1'

642603

Institutional Source

Beutler Lab

Gene Symbol

Ston1

Ensembl Gene

ENSMUSG00000033855

Gene Name

stonin 1

Synonyms

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.161) question?

Stock #

BB010

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

88597684-88662586 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 88636144 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 326 (E326G)

Ref Sequence

ENSEMBL: ENSMUSP00000131703 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064035] [ENSMUST00000137138] [ENSMUST00000150023] [ENSMUST00000163588]

AlphaFold

Q8CDJ8

Predicted Effect

probably benign
Transcript: ENSMUST00000064035
AA Change: E326G

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000067027
Gene: ENSMUSG00000033855
AA Change: E326G

Domain	Start	End	E-Value	Type
low complexity region	50	65	N/A	INTRINSIC
low complexity region	132	143	N/A	INTRINSIC
low complexity region	380	391	N/A	INTRINSIC
Pfam:Adap_comp_sub	396	707	5.5e-64	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000137138

SMART Domains

Protein: ENSMUSP00000118522
Gene: ENSMUSG00000033855

Domain	Start	End	E-Value	Type
low complexity region	50	65	N/A	INTRINSIC
low complexity region	132	143	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000150023
AA Change: E326G

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000122928
Gene: ENSMUSG00000033855
AA Change: E326G

Domain	Start	End	E-Value	Type
low complexity region	50	65	N/A	INTRINSIC
low complexity region	132	143	N/A	INTRINSIC
low complexity region	380	391	N/A	INTRINSIC
Pfam:Adap_comp_sub	396	707	5.5e-64	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000163588
AA Change: E326G

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000131703
Gene: ENSMUSG00000033855
AA Change: E326G

Domain	Start	End	E-Value	Type
low complexity region	50	65	N/A	INTRINSIC
low complexity region	132	143	N/A	INTRINSIC
low complexity region	380	391	N/A	INTRINSIC
Pfam:Adap_comp_sub	396	711	2.1e-64	PFAM

Meta Mutation Damage Score

0.4035

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Endocytosis of cell surface proteins is mediated by a complex molecular machinery that assembles on the inner surface of the plasma membrane. This gene encodes one of two human homologs of the Drosophila melanogaster stoned B protein. This protein is related to components of the endocytic machinery and exhibits a modular structure consisting of an N-terminal proline-rich domain, a central region of homology specific to the human stoned B-like proteins, and a C-terminal region homologous to the mu subunits of adaptor protein (AP) complexes. Read-through transcription of this gene into the neighboring downstream gene, which encodes TFIIA-alpha/beta-like factor, generates a transcript (SALF), which encodes a fusion protein comprised of sequence sharing identity with each individual gene product. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are overtly normal. Mouse embryonic fibroblasts derived from homozygous null mice display alterations in focal adhesion dynamics and an increase in cellular signaling and directional cell migration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	A	G	13: 59,743,751	L85P	probably damaging	Het
4933414I15Rik	A	G	11: 50,942,400	V125A	unknown	Het
Adam34	T	A	8: 43,650,874	H578L	probably damaging	Het
Ago4	A	T	4: 126,507,018	M678K	probably benign	Het
Atrn	T	C	2: 130,995,066	L1150P	probably damaging	Het
Camta1	C	T	4: 151,083,757	E279K	probably damaging	Het
Ccdc88c	T	C	12: 100,945,490	D695G	possibly damaging	Het
Col11a2	A	T	17: 34,056,055	K400*	probably null	Het
Cpsf4	T	A	5: 145,167,358	M1K	probably null	Het
Dnah12	A	T	14: 26,766,115	Q992L	probably benign	Het
Dnajc7	T	C	11: 100,596,212	Y145C	probably damaging	Het
Eml5	A	T	12: 98,844,020	D892E	possibly damaging	Het
Fam193a	A	G	5: 34,466,195	K23E	possibly damaging	Het
Fam214b	A	T	4: 43,035,919	C271S	probably benign	Het
Filip1	T	G	9: 79,820,047	K430T	possibly damaging	Het
Gm5089	T	C	14: 122,435,991	D106G	unknown	Het
Hip1	A	T	5: 135,460,456	N45K	probably damaging	Het
Hivep2	T	C	10: 14,127,837	S60P	probably damaging	Het
Ighv1-53	A	T	12: 115,158,409	C115*	probably null	Het
Macf1	T	C	4: 123,409,651	T353A	probably benign	Het
Mast3	A	T	8: 70,786,635	V433E	probably damaging	Het
Mast4	A	T	13: 102,772,563	M660K	probably damaging	Het
Nr2e1	T	C	10: 42,563,383	Y380C	probably damaging	Het
Olfr1465	T	A	19: 13,314,205	M27L	probably benign	Het
Olfr980	T	C	9: 40,007,135		probably benign	Het
Otog	A	G	7: 46,310,147	D720G	probably damaging	Het
Slc6a1	T	A	6: 114,311,898	W473R	probably damaging	Het
Smpd3	A	C	8: 106,255,622	C617G	probably benign	Het
Sprr3	T	C	3: 92,457,208	I110V	possibly damaging	Het
Tapbpl	T	G	6: 125,230,270	Q152P	probably damaging	Het
Tectb	C	T	19: 55,194,673	L319F	possibly damaging	Het
Tpp2	G	A	1: 43,960,961	G413D	probably damaging	Het
Tpsg1	A	G	17: 25,373,204	H84R	probably damaging	Het
Usp24	A	G	4: 106,428,489	N2437S	probably benign	Het
Usp32	T	C	11: 85,007,059	Q1152R	probably damaging	Het
Vmn2r6	T	C	3: 64,559,803	T92A	probably benign	Het
Xpo7	A	G	14: 70,707,348	V35A	probably benign	Het
Zan	T	A	5: 137,463,579	T1113S	unknown	Het
Zfp169	A	G	13: 48,490,481	V390A	unknown	Het

Other mutations in Ston1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01092:Ston1	APN	17	88644443	missense	probably benign	0.00
IGL01593:Ston1	APN	17	88637010	missense	probably null	1.00
BB020:Ston1	UTSW	17	88636144	missense	probably benign	0.10
FR4449:Ston1	UTSW	17	88635525	missense	probably benign	0.38
R0610:Ston1	UTSW	17	88635281	missense	possibly damaging	0.49
R1421:Ston1	UTSW	17	88635793	missense	probably benign	0.02
R1620:Ston1	UTSW	17	88635816	missense	probably benign	0.01
R2002:Ston1	UTSW	17	88635529	missense	probably benign	0.01
R3108:Ston1	UTSW	17	88636155	nonsense	probably null
R3766:Ston1	UTSW	17	88635360	missense	probably damaging	1.00
R4222:Ston1	UTSW	17	88636771	missense	probably damaging	1.00
R4335:Ston1	UTSW	17	88635697	missense	probably damaging	1.00
R4355:Ston1	UTSW	17	88637008	missense	probably damaging	1.00
R4867:Ston1	UTSW	17	88635694	missense	probably damaging	1.00
R4902:Ston1	UTSW	17	88645252	missense	probably damaging	0.99
R5084:Ston1	UTSW	17	88636574	missense	probably benign	0.00
R5434:Ston1	UTSW	17	88645311	utr 3 prime	probably benign
R5700:Ston1	UTSW	17	88644339	missense	probably damaging	1.00
R5858:Ston1	UTSW	17	88635631	missense	possibly damaging	0.93
R5863:Ston1	UTSW	17	88635945	missense	possibly damaging	0.64
R6458:Ston1	UTSW	17	88635303	missense	probably benign	0.14
R6459:Ston1	UTSW	17	88636468	missense	probably benign	0.16
R7012:Ston1	UTSW	17	88635985	missense	probably damaging	1.00
R7466:Ston1	UTSW	17	88635901	missense	probably benign	0.03
R7825:Ston1	UTSW	17	88636453	missense	possibly damaging	0.78
R7933:Ston1	UTSW	17	88636144	missense	probably benign	0.10
R8505:Ston1	UTSW	17	88635589	missense	probably benign	0.35
R8876:Ston1	UTSW	17	88635172	missense	probably benign
R9050:Ston1	UTSW	17	88636800	missense	probably benign	0.00
R9429:Ston1	UTSW	17	88635606	missense	probably benign
R9798:Ston1	UTSW	17	88637044	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GACACAGTCTCGTTTGTCCC -3'
(R):5'- TCAGAAACTCGAGGAAGTCAC -3'

Sequencing Primer
(F):5'- TTCCGGAGTCAGCCCAGAG -3'
(R):5'- ACTCGAGGAAGTCACGGTGTTC -3'

Posted On

2020-08-01