Incidental Mutation 'BB010:Or5b111'
ID 642604
Institutional Source Beutler Lab
Gene Symbol Or5b111
Ensembl Gene ENSMUSG00000062199
Gene Name olfactory receptor family 5 subfamily B member 111
Synonyms MOR202-28, GA_x6K02T2RE5P-3645346-3644423, Olfr1465
Accession Numbers
Essential gene? Probably non essential (E-score: 0.089) question?
Stock # BB010
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 13290724-13291647 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 13291569 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 27 (M27L)
Ref Sequence ENSEMBL: ENSMUSP00000146645 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080142] [ENSMUST00000207340]
AlphaFold Q7TQR2
Predicted Effect probably benign
Transcript: ENSMUST00000080142
AA Change: M27L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000079039
Gene: ENSMUSG00000062199
AA Change: M27L

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 7.4e-47 PFAM
Pfam:7tm_1 39 288 3.7e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207340
AA Change: M27L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933414I15Rik A G 11: 50,833,227 (GRCm39) V125A unknown Het
Adam34 T A 8: 44,103,911 (GRCm39) H578L probably damaging Het
Ago4 A T 4: 126,400,811 (GRCm39) M678K probably benign Het
Atosb A T 4: 43,035,919 (GRCm39) C271S probably benign Het
Atrn T C 2: 130,836,986 (GRCm39) L1150P probably damaging Het
Camta1 C T 4: 151,168,214 (GRCm39) E279K probably damaging Het
Ccdc88c T C 12: 100,911,749 (GRCm39) D695G possibly damaging Het
Col11a2 A T 17: 34,275,029 (GRCm39) K400* probably null Het
Cpsf4 T A 5: 145,104,168 (GRCm39) M1K probably null Het
Dnah12 A T 14: 26,488,072 (GRCm39) Q992L probably benign Het
Dnajc7 T C 11: 100,487,038 (GRCm39) Y145C probably damaging Het
Eml5 A T 12: 98,810,279 (GRCm39) D892E possibly damaging Het
Fam193a A G 5: 34,623,539 (GRCm39) K23E possibly damaging Het
Filip1 T G 9: 79,727,329 (GRCm39) K430T possibly damaging Het
Gm5089 T C 14: 122,673,403 (GRCm39) D106G unknown Het
Hip1 A T 5: 135,489,310 (GRCm39) N45K probably damaging Het
Hivep2 T C 10: 14,003,581 (GRCm39) S60P probably damaging Het
Ighv1-53 A T 12: 115,122,029 (GRCm39) C115* probably null Het
Macf1 T C 4: 123,303,444 (GRCm39) T353A probably benign Het
Mast3 A T 8: 71,239,279 (GRCm39) V433E probably damaging Het
Mast4 A T 13: 102,909,071 (GRCm39) M660K probably damaging Het
Nr2e1 T C 10: 42,439,379 (GRCm39) Y380C probably damaging Het
Or10g9b T C 9: 39,918,431 (GRCm39) probably benign Het
Otog A G 7: 45,959,571 (GRCm39) D720G probably damaging Het
Slc6a1 T A 6: 114,288,859 (GRCm39) W473R probably damaging Het
Smpd3 A C 8: 106,982,254 (GRCm39) C617G probably benign Het
Spata31d1e A G 13: 59,891,565 (GRCm39) L85P probably damaging Het
Sprr3 T C 3: 92,364,515 (GRCm39) I110V possibly damaging Het
Ston1 A G 17: 88,943,572 (GRCm39) E326G probably benign Het
Tapbpl T G 6: 125,207,233 (GRCm39) Q152P probably damaging Het
Tectb C T 19: 55,183,105 (GRCm39) L319F possibly damaging Het
Tpp2 G A 1: 44,000,121 (GRCm39) G413D probably damaging Het
Tpsg1 A G 17: 25,592,178 (GRCm39) H84R probably damaging Het
Usp24 A G 4: 106,285,686 (GRCm39) N2437S probably benign Het
Usp32 T C 11: 84,897,885 (GRCm39) Q1152R probably damaging Het
Vmn2r6 T C 3: 64,467,224 (GRCm39) T92A probably benign Het
Xpo7 A G 14: 70,944,788 (GRCm39) V35A probably benign Het
Zan T A 5: 137,461,841 (GRCm39) T1113S unknown Het
Zfp169 A G 13: 48,643,957 (GRCm39) V390A unknown Het
Other mutations in Or5b111
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01296:Or5b111 APN 19 13,291,490 (GRCm39) missense probably damaging 1.00
IGL01548:Or5b111 APN 19 13,291,350 (GRCm39) missense possibly damaging 0.95
IGL02548:Or5b111 APN 19 13,291,302 (GRCm39) missense probably damaging 0.98
IGL02663:Or5b111 APN 19 13,290,743 (GRCm39) missense probably benign 0.01
BB020:Or5b111 UTSW 19 13,291,569 (GRCm39) missense probably benign
PIT4651001:Or5b111 UTSW 19 13,291,556 (GRCm39) missense probably benign 0.12
R0563:Or5b111 UTSW 19 13,291,112 (GRCm39) missense probably benign 0.28
R1803:Or5b111 UTSW 19 13,291,535 (GRCm39) missense possibly damaging 0.90
R2146:Or5b111 UTSW 19 13,291,485 (GRCm39) missense probably benign 0.23
R4674:Or5b111 UTSW 19 13,291,178 (GRCm39) missense probably benign 0.17
R4697:Or5b111 UTSW 19 13,291,081 (GRCm39) missense probably benign 0.39
R4825:Or5b111 UTSW 19 13,291,684 (GRCm39) splice site probably null
R4884:Or5b111 UTSW 19 13,291,034 (GRCm39) missense probably benign 0.28
R5647:Or5b111 UTSW 19 13,291,553 (GRCm39) missense probably damaging 1.00
R6401:Or5b111 UTSW 19 13,290,878 (GRCm39) missense probably damaging 1.00
R6913:Or5b111 UTSW 19 13,290,998 (GRCm39) missense probably benign 0.01
R6996:Or5b111 UTSW 19 13,291,036 (GRCm39) missense probably benign 0.15
R7933:Or5b111 UTSW 19 13,291,569 (GRCm39) missense probably benign
R8946:Or5b111 UTSW 19 13,291,502 (GRCm39) missense probably damaging 0.97
R8966:Or5b111 UTSW 19 13,291,196 (GRCm39) missense probably damaging 1.00
R9641:Or5b111 UTSW 19 13,291,100 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACCCATTATAGGATATGACCTTGTCTC -3'
(R):5'- TTGCTCAACCAAGTCATATGTTTGC -3'

Sequencing Primer
(F):5'- AGGATATGACCTTGTCTCCTTTTAG -3'
(R):5'- TTAAATGTAACAGTGATGGAGA -3'
Posted On 2020-08-01