Mutagenetix > Incidental Mutation

Incidental Mutation 'BB010:Tectb'

642605

Institutional Source

Beutler Lab

Gene Symbol

Tectb

Ensembl Gene

ENSMUSG00000024979

Gene Name

tectorin beta

Synonyms

[b]-tectorin, Tctnb

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.091) question?

Stock #

BB010

Quality Score

201.009

Status

Not validated

Chromosome

Chromosomal Location

55180733-55196313 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 55194673 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Phenylalanine at position 319 (L319F)

Ref Sequence

ENSEMBL: ENSMUSP00000025936 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025936] [ENSMUST00000069183] [ENSMUST00000120936]

AlphaFold

O08524

Predicted Effect

possibly damaging
Transcript: ENSMUST00000025936
AA Change: L319F

PolyPhen 2 Score 0.873 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000025936
Gene: ENSMUSG00000024979
AA Change: L319F

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
ZP	31	283	3.47e-50	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000069183

SMART Domains

Protein: ENSMUSP00000068253
Gene: ENSMUSG00000055523

Domain	Start	End	E-Value	Type
low complexity region	27	38	N/A	INTRINSIC
Pfam:ANF_receptor	65	416	5.2e-36	PFAM
low complexity region	471	487	N/A	INTRINSIC
Pfam:Pkinase	574	826	2e-26	PFAM
Pfam:Pkinase_Tyr	577	826	6e-35	PFAM
CYCc	865	1059	6.42e-96	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000120936
AA Change: L329F

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000113805
Gene: ENSMUSG00000024979
AA Change: L329F

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
ZP	31	293	1.9e-47	SMART

Predicted Effect

SMART Domains

Protein: ENSMUSP00000117645
Gene: ENSMUSG00000024979
AA Change: L170F

Domain	Start	End	E-Value	Type
Pfam:Zona_pellucida	3	116	5.9e-27	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a non-collagenous glycoprotein component of the tectorial membrane, which covers the auditory hair cells in the cochlea of the inner ear. A similar protein in mouse functions in low-frequency hearing. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygotes for a null allele show an enlarged tectorial membrane with a disrupted striated-sheet matrix, absence of the marginal band, and low-frequency hearing loss. However, basilar-membrane and neural tuning are both enhanced in high-frequency cochlear regions, with little loss in sensitivity. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	A	G	13: 59,743,751	L85P	probably damaging	Het
4933414I15Rik	A	G	11: 50,942,400	V125A	unknown	Het
Adam34	T	A	8: 43,650,874	H578L	probably damaging	Het
Ago4	A	T	4: 126,507,018	M678K	probably benign	Het
Atrn	T	C	2: 130,995,066	L1150P	probably damaging	Het
Camta1	C	T	4: 151,083,757	E279K	probably damaging	Het
Ccdc88c	T	C	12: 100,945,490	D695G	possibly damaging	Het
Col11a2	A	T	17: 34,056,055	K400*	probably null	Het
Cpsf4	T	A	5: 145,167,358	M1K	probably null	Het
Dnah12	A	T	14: 26,766,115	Q992L	probably benign	Het
Dnajc7	T	C	11: 100,596,212	Y145C	probably damaging	Het
Eml5	A	T	12: 98,844,020	D892E	possibly damaging	Het
Fam193a	A	G	5: 34,466,195	K23E	possibly damaging	Het
Fam214b	A	T	4: 43,035,919	C271S	probably benign	Het
Filip1	T	G	9: 79,820,047	K430T	possibly damaging	Het
Gm5089	T	C	14: 122,435,991	D106G	unknown	Het
Hip1	A	T	5: 135,460,456	N45K	probably damaging	Het
Hivep2	T	C	10: 14,127,837	S60P	probably damaging	Het
Ighv1-53	A	T	12: 115,158,409	C115*	probably null	Het
Macf1	T	C	4: 123,409,651	T353A	probably benign	Het
Mast3	A	T	8: 70,786,635	V433E	probably damaging	Het
Mast4	A	T	13: 102,772,563	M660K	probably damaging	Het
Nr2e1	T	C	10: 42,563,383	Y380C	probably damaging	Het
Olfr1465	T	A	19: 13,314,205	M27L	probably benign	Het
Olfr980	T	C	9: 40,007,135		probably benign	Het
Otog	A	G	7: 46,310,147	D720G	probably damaging	Het
Slc6a1	T	A	6: 114,311,898	W473R	probably damaging	Het
Smpd3	A	C	8: 106,255,622	C617G	probably benign	Het
Sprr3	T	C	3: 92,457,208	I110V	possibly damaging	Het
Ston1	A	G	17: 88,636,144	E326G	probably benign	Het
Tapbpl	T	G	6: 125,230,270	Q152P	probably damaging	Het
Tpp2	G	A	1: 43,960,961	G413D	probably damaging	Het
Tpsg1	A	G	17: 25,373,204	H84R	probably damaging	Het
Usp24	A	G	4: 106,428,489	N2437S	probably benign	Het
Usp32	T	C	11: 85,007,059	Q1152R	probably damaging	Het
Vmn2r6	T	C	3: 64,559,803	T92A	probably benign	Het
Xpo7	A	G	14: 70,707,348	V35A	probably benign	Het
Zan	T	A	5: 137,463,579	T1113S	unknown	Het
Zfp169	A	G	13: 48,490,481	V390A	unknown	Het

Other mutations in Tectb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01754:Tectb	APN	19	55184013	missense	probably damaging	1.00
IGL02001:Tectb	APN	19	55189595	missense	possibly damaging	0.48
IGL02510:Tectb	APN	19	55191511	missense	probably damaging	1.00
BB020:Tectb	UTSW	19	55194673	missense	possibly damaging	0.87
R0028:Tectb	UTSW	19	55194677	missense	probably benign	0.01
R0130:Tectb	UTSW	19	55181961	missense	probably damaging	0.99
R0586:Tectb	UTSW	19	55181924	missense	probably damaging	1.00
R0598:Tectb	UTSW	19	55189586	nonsense	probably null
R0655:Tectb	UTSW	19	55189870	missense	possibly damaging	0.78
R0708:Tectb	UTSW	19	55191552	missense	probably benign	0.37
R1314:Tectb	UTSW	19	55183985	missense	probably damaging	1.00
R1999:Tectb	UTSW	19	55180999	start gained	probably benign
R2000:Tectb	UTSW	19	55180999	start gained	probably benign
R2024:Tectb	UTSW	19	55181929	missense	probably damaging	1.00
R2148:Tectb	UTSW	19	55180999	start gained	probably benign
R2159:Tectb	UTSW	19	55180999	start gained	probably benign
R2160:Tectb	UTSW	19	55180999	start gained	probably benign
R2161:Tectb	UTSW	19	55180999	start gained	probably benign
R2162:Tectb	UTSW	19	55180999	start gained	probably benign
R2355:Tectb	UTSW	19	55180999	start gained	probably benign
R2358:Tectb	UTSW	19	55180999	start gained	probably benign
R2495:Tectb	UTSW	19	55180999	start gained	probably benign
R2497:Tectb	UTSW	19	55180999	start gained	probably benign
R2511:Tectb	UTSW	19	55180999	start gained	probably benign
R2568:Tectb	UTSW	19	55180999	start gained	probably benign
R2570:Tectb	UTSW	19	55180999	start gained	probably benign
R2848:Tectb	UTSW	19	55180999	start gained	probably benign
R2897:Tectb	UTSW	19	55180999	start gained	probably benign
R2898:Tectb	UTSW	19	55180999	start gained	probably benign
R3712:Tectb	UTSW	19	55180999	start gained	probably benign
R5671:Tectb	UTSW	19	55192627	missense	probably benign	0.42
R5875:Tectb	UTSW	19	55189626	missense	possibly damaging	0.94
R6312:Tectb	UTSW	19	55192662	frame shift	probably null
R6315:Tectb	UTSW	19	55191472	missense	possibly damaging	0.73
R6366:Tectb	UTSW	19	55181918	missense	probably damaging	1.00
R7729:Tectb	UTSW	19	55192672	missense
R7933:Tectb	UTSW	19	55194673	missense	possibly damaging	0.87
R8408:Tectb	UTSW	19	55189667	critical splice donor site	probably null
R8557:Tectb	UTSW	19	55192673	unclassified	probably benign
R8835:Tectb	UTSW	19	55183838	missense	probably benign	0.43
R8918:Tectb	UTSW	19	55191568	missense	probably damaging	1.00
R8935:Tectb	UTSW	19	55194700	missense	probably benign
R9239:Tectb	UTSW	19	55192662	frame shift	probably null
R9345:Tectb	UTSW	19	55194665	missense	probably benign	0.00
R9467:Tectb	UTSW	19	55192661	missense

Predicted Primers

PCR Primer
(F):5'- AGCCAGATGTCTGTTTGCC -3'
(R):5'- TATTTGGCAAAGGGCTGTTCC -3'

Sequencing Primer
(F):5'- CTAGTAGGGCCTCTGTCCTCTAGAAG -3'
(R):5'- TGTTCCCAGCTCCCCAG -3'

Posted On

2020-08-01