Incidental Mutation 'BB011:Serpinb3c'
ID642608
Institutional Source Beutler Lab
Gene Symbol Serpinb3c
Ensembl Gene ENSMUSG00000073601
Gene Nameserine (or cysteine) peptidase inhibitor, clade B, member 3C
Synonyms1110001H02Rik, Scca2, Serpinb4, ovalbumin, 1110013A16Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #BB011
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location107271201-107278371 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 107273174 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 171 (L171P)
Ref Sequence ENSEMBL: ENSMUSP00000027565 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027565] [ENSMUST00000166100]
Predicted Effect probably damaging
Transcript: ENSMUST00000027565
AA Change: L171P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027565
Gene: ENSMUSG00000073601
AA Change: L171P

DomainStartEndE-ValueType
SERPIN 13 386 7.91e-169 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166100
SMART Domains Protein: ENSMUSP00000132370
Gene: ENSMUSG00000073602

DomainStartEndE-ValueType
SERPIN 13 387 4.75e-181 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930435E12Rik G A 16: 38,812,464 Q369* probably null Het
Acacb A G 5: 114,245,220 K2155E possibly damaging Het
Adgre5 G A 8: 83,729,400 P256S possibly damaging Het
Adipor1 T A 1: 134,425,993 V172D probably damaging Het
Ahsa1 T C 12: 87,270,456 probably null Het
Ankrd11 T C 8: 122,895,902 I404V possibly damaging Het
Asxl3 G A 18: 22,525,545 R2204Q probably damaging Het
Barhl2 A G 5: 106,457,649 S65P unknown Het
Bbx A T 16: 50,224,308 L630H probably damaging Het
Cars T C 7: 143,569,871 T531A possibly damaging Het
Catsperb T A 12: 101,520,565 H450Q probably benign Het
Cdt1 T C 8: 122,569,352 L135P probably damaging Het
Cfap206 T A 4: 34,728,833 H24L probably benign Het
Cnga4 T A 7: 105,407,821 V480E probably benign Het
Cnot1 ACG A 8: 95,745,647 probably null Het
Ctcfl G A 2: 173,113,656 T271I possibly damaging Het
Dlc1 T C 8: 36,571,416 R1003G probably benign Het
Dnah7b A G 1: 46,219,430 D1927G probably benign Het
Dscc1 A T 15: 55,082,176 D374E probably benign Het
Eci2 G A 13: 34,993,070 Q69* probably null Het
Ep300 C A 15: 81,649,502 P1920Q unknown Het
Epha5 A G 5: 84,084,846 Y629H possibly damaging Het
Fam208b A T 13: 3,594,331 F129Y possibly damaging Het
Fat2 G A 11: 55,262,787 T3533I probably benign Het
Fat3 T C 9: 15,999,297 N1803S probably damaging Het
Fcrls T C 3: 87,259,533 Y51C probably damaging Het
G530012D18Rik C G 1: 85,577,214 D113E unknown Het
Gcnt2 A T 13: 40,918,564 K228* probably null Het
Gucy2c A T 6: 136,763,055 V258E probably benign Het
Hecw1 C A 13: 14,322,528 L298F probably damaging Het
Hydin T G 8: 110,418,471 V818G possibly damaging Het
Hykk A G 9: 54,922,240 Y131C probably damaging Het
Ick T C 9: 78,155,464 L260P probably damaging Het
Mpo A G 11: 87,794,840 D48G probably damaging Het
Mrps10 T C 17: 47,378,283 *202Q probably null Het
Mrps14 T C 1: 160,196,989 V30A probably benign Het
Mtmr7 G A 8: 40,606,884 A62V possibly damaging Het
Muc2 G T 7: 141,695,388 G497W probably damaging Het
Nnt A T 13: 119,386,645 V237D probably damaging Het
Nox4 G T 7: 87,374,381 V492L probably benign Het
Obscn C G 11: 59,112,555 E1306Q probably benign Het
Olfr303 A G 7: 86,394,730 I256T probably damaging Het
Olfr993 T C 2: 85,414,219 Y220C probably benign Het
Pard3 A G 8: 127,410,750 N861S probably benign Het
Pdlim4 G A 11: 54,055,222 R230* probably null Het
Pinlyp C T 7: 24,542,125 V159M possibly damaging Het
Plcb1 A T 2: 135,359,693 T855S probably benign Het
Pot1a T A 6: 25,753,310 D409V possibly damaging Het
Prom1 T C 5: 44,029,769 D382G probably benign Het
Prss16 A T 13: 22,008,664 N83K probably damaging Het
Ptprn2 A G 12: 116,841,264 D133G probably benign Het
Rasef C T 4: 73,740,929 probably null Het
Rbak A G 5: 143,174,486 S271P probably damaging Het
Rbm20 A T 19: 53,677,585 I60F possibly damaging Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Rsf1 G GACGGCCGCC 7: 97,579,909 probably benign Het
Slc25a19 T C 11: 115,615,550 Y211C unknown Het
Sorbs2 C T 8: 45,795,470 S586L probably damaging Het
Spesp1 A T 9: 62,273,451 S58R probably benign Het
Spryd3 A G 15: 102,118,327 I329T probably benign Het
St8sia2 G A 7: 73,966,952 L113F probably damaging Het
Star T C 8: 25,809,855 I75T possibly damaging Het
Tdrd6 T A 17: 43,627,806 I784F possibly damaging Het
Tsc22d4 A G 5: 137,768,011 I144V unknown Het
Tspan8 T C 10: 115,833,324 probably null Het
Ttll9 C T 2: 152,962,487 probably benign Het
Ubr4 T G 4: 139,467,276 L1160R unknown Het
Ufd1 A G 16: 18,823,285 Y162C possibly damaging Het
Unc13c A T 9: 73,734,408 F1268I probably benign Het
Uvssa T C 5: 33,410,951 I561T probably damaging Het
Vmn2r15 A T 5: 109,286,388 S817T probably damaging Het
Ybx1 T C 4: 119,282,279 E173G probably damaging Het
Zc3h6 T C 2: 129,015,480 S640P possibly damaging Het
Other mutations in Serpinb3c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00847:Serpinb3c APN 1 107276260 critical splice donor site probably null
IGL01349:Serpinb3c APN 1 107272783 missense probably damaging 1.00
IGL01730:Serpinb3c APN 1 107273184 missense probably damaging 0.99
IGL01732:Serpinb3c APN 1 107271972 missense probably benign
IGL02184:Serpinb3c APN 1 107271918 missense probably damaging 0.96
IGL02742:Serpinb3c APN 1 107273142 nonsense probably null
IGL03131:Serpinb3c APN 1 107271727 missense probably benign 0.09
IGL03394:Serpinb3c APN 1 107271873 missense probably benign 0.00
BB001:Serpinb3c UTSW 1 107273174 missense probably damaging 1.00
R0207:Serpinb3c UTSW 1 107276992 missense probably benign 0.02
R0508:Serpinb3c UTSW 1 107276921 missense probably damaging 1.00
R1542:Serpinb3c UTSW 1 107272787 missense probably damaging 1.00
R1660:Serpinb3c UTSW 1 107271702 missense probably damaging 1.00
R1731:Serpinb3c UTSW 1 107271774 missense probably damaging 0.99
R2012:Serpinb3c UTSW 1 107271844 missense possibly damaging 0.92
R5361:Serpinb3c UTSW 1 107276931 nonsense probably null
R5464:Serpinb3c UTSW 1 107271704 missense probably damaging 0.99
R5636:Serpinb3c UTSW 1 107275014 missense possibly damaging 0.57
R5677:Serpinb3c UTSW 1 107271803 missense probably damaging 1.00
R5965:Serpinb3c UTSW 1 107276923 missense probably benign 0.01
R6424:Serpinb3c UTSW 1 107271629 makesense probably null
R7132:Serpinb3c UTSW 1 107276951 missense probably damaging 0.96
R7161:Serpinb3c UTSW 1 107273162 missense probably null 1.00
R7319:Serpinb3c UTSW 1 107273087 missense possibly damaging 0.92
R7437:Serpinb3c UTSW 1 107271714 missense probably damaging 1.00
R7871:Serpinb3c UTSW 1 107273153 missense possibly damaging 0.95
R7922:Serpinb3c UTSW 1 107272014 missense probably damaging 1.00
R7924:Serpinb3c UTSW 1 107273174 missense probably damaging 1.00
R8114:Serpinb3c UTSW 1 107276304 missense probably benign 0.03
R8189:Serpinb3c UTSW 1 107276309 missense probably benign 0.00
R8384:Serpinb3c UTSW 1 107271967 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TCTTTGAAGATAGAACCCTGAGG -3'
(R):5'- AGCACATTGAGGAAGGCTATATCC -3'

Sequencing Primer
(F):5'- AGGCCAACAGTACCTTGT -3'
(R):5'- GGAAGGCTATATCCTATGAACAGATC -3'
Posted On2020-08-01