Incidental Mutation 'BB011:Olfr993'
ID642611
Institutional Source Beutler Lab
Gene Symbol Olfr993
Ensembl Gene ENSMUSG00000075220
Gene Nameolfactory receptor 993
SynonymsGA_x6K02T2Q125-46891524-46890580, MOR203-2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.160) question?
Stock #BB011
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location85413933-85414877 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 85414219 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 220 (Y220C)
Ref Sequence ENSEMBL: ENSMUSP00000097510 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099926] [ENSMUST00000213749] [ENSMUST00000214895] [ENSMUST00000215617]
Predicted Effect probably benign
Transcript: ENSMUST00000099926
AA Change: Y220C

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000097510
Gene: ENSMUSG00000075220
AA Change: Y220C

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 3e-51 PFAM
Pfam:7TM_GPCR_Srsx 35 303 1.3e-7 PFAM
Pfam:7tm_1 41 290 2.2e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213749
Predicted Effect probably benign
Transcript: ENSMUST00000214895
Predicted Effect probably benign
Transcript: ENSMUST00000215617
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930435E12Rik G A 16: 38,812,464 Q369* probably null Het
Acacb A G 5: 114,245,220 K2155E possibly damaging Het
Adgre5 G A 8: 83,729,400 P256S possibly damaging Het
Adipor1 T A 1: 134,425,993 V172D probably damaging Het
Ahsa1 T C 12: 87,270,456 probably null Het
Ankrd11 T C 8: 122,895,902 I404V possibly damaging Het
Asxl3 G A 18: 22,525,545 R2204Q probably damaging Het
Barhl2 A G 5: 106,457,649 S65P unknown Het
Bbx A T 16: 50,224,308 L630H probably damaging Het
Cars T C 7: 143,569,871 T531A possibly damaging Het
Catsperb T A 12: 101,520,565 H450Q probably benign Het
Cdt1 T C 8: 122,569,352 L135P probably damaging Het
Cfap206 T A 4: 34,728,833 H24L probably benign Het
Cnga4 T A 7: 105,407,821 V480E probably benign Het
Cnot1 ACG A 8: 95,745,647 probably null Het
Ctcfl G A 2: 173,113,656 T271I possibly damaging Het
Dlc1 T C 8: 36,571,416 R1003G probably benign Het
Dnah7b A G 1: 46,219,430 D1927G probably benign Het
Dscc1 A T 15: 55,082,176 D374E probably benign Het
Eci2 G A 13: 34,993,070 Q69* probably null Het
Ep300 C A 15: 81,649,502 P1920Q unknown Het
Epha5 A G 5: 84,084,846 Y629H possibly damaging Het
Fam208b A T 13: 3,594,331 F129Y possibly damaging Het
Fat2 G A 11: 55,262,787 T3533I probably benign Het
Fat3 T C 9: 15,999,297 N1803S probably damaging Het
Fcrls T C 3: 87,259,533 Y51C probably damaging Het
G530012D18Rik C G 1: 85,577,214 D113E unknown Het
Gcnt2 A T 13: 40,918,564 K228* probably null Het
Gucy2c A T 6: 136,763,055 V258E probably benign Het
Hecw1 C A 13: 14,322,528 L298F probably damaging Het
Hydin T G 8: 110,418,471 V818G possibly damaging Het
Hykk A G 9: 54,922,240 Y131C probably damaging Het
Ick T C 9: 78,155,464 L260P probably damaging Het
Mpo A G 11: 87,794,840 D48G probably damaging Het
Mrps10 T C 17: 47,378,283 *202Q probably null Het
Mrps14 T C 1: 160,196,989 V30A probably benign Het
Mtmr7 G A 8: 40,606,884 A62V possibly damaging Het
Muc2 G T 7: 141,695,388 G497W probably damaging Het
Nnt A T 13: 119,386,645 V237D probably damaging Het
Nox4 G T 7: 87,374,381 V492L probably benign Het
Obscn C G 11: 59,112,555 E1306Q probably benign Het
Olfr303 A G 7: 86,394,730 I256T probably damaging Het
Pard3 A G 8: 127,410,750 N861S probably benign Het
Pdlim4 G A 11: 54,055,222 R230* probably null Het
Pinlyp C T 7: 24,542,125 V159M possibly damaging Het
Plcb1 A T 2: 135,359,693 T855S probably benign Het
Pot1a T A 6: 25,753,310 D409V possibly damaging Het
Prom1 T C 5: 44,029,769 D382G probably benign Het
Prss16 A T 13: 22,008,664 N83K probably damaging Het
Ptprn2 A G 12: 116,841,264 D133G probably benign Het
Rasef C T 4: 73,740,929 probably null Het
Rbak A G 5: 143,174,486 S271P probably damaging Het
Rbm20 A T 19: 53,677,585 I60F possibly damaging Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Rsf1 G GACGGCCGCC 7: 97,579,909 probably benign Het
Serpinb3c A G 1: 107,273,174 L171P probably damaging Het
Slc25a19 T C 11: 115,615,550 Y211C unknown Het
Sorbs2 C T 8: 45,795,470 S586L probably damaging Het
Spesp1 A T 9: 62,273,451 S58R probably benign Het
Spryd3 A G 15: 102,118,327 I329T probably benign Het
St8sia2 G A 7: 73,966,952 L113F probably damaging Het
Star T C 8: 25,809,855 I75T possibly damaging Het
Tdrd6 T A 17: 43,627,806 I784F possibly damaging Het
Tsc22d4 A G 5: 137,768,011 I144V unknown Het
Tspan8 T C 10: 115,833,324 probably null Het
Ttll9 C T 2: 152,962,487 probably benign Het
Ubr4 T G 4: 139,467,276 L1160R unknown Het
Ufd1 A G 16: 18,823,285 Y162C possibly damaging Het
Unc13c A T 9: 73,734,408 F1268I probably benign Het
Uvssa T C 5: 33,410,951 I561T probably damaging Het
Vmn2r15 A T 5: 109,286,388 S817T probably damaging Het
Ybx1 T C 4: 119,282,279 E173G probably damaging Het
Zc3h6 T C 2: 129,015,480 S640P possibly damaging Het
Other mutations in Olfr993
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02428:Olfr993 APN 2 85414193 missense probably benign 0.05
IGL03209:Olfr993 APN 2 85414379 missense probably benign 0.05
BB001:Olfr993 UTSW 2 85414219 missense probably benign 0.06
R0591:Olfr993 UTSW 2 85414690 missense possibly damaging 0.95
R1437:Olfr993 UTSW 2 85414874 missense probably benign 0.01
R1836:Olfr993 UTSW 2 85414405 missense probably benign 0.36
R2084:Olfr993 UTSW 2 85414615 missense probably benign 0.01
R2902:Olfr993 UTSW 2 85414052 missense possibly damaging 0.79
R2910:Olfr993 UTSW 2 85414351 missense probably damaging 1.00
R3961:Olfr993 UTSW 2 85414872 missense possibly damaging 0.69
R4542:Olfr993 UTSW 2 85413943 missense probably benign
R4635:Olfr993 UTSW 2 85414864 missense probably damaging 1.00
R5464:Olfr993 UTSW 2 85414713 frame shift probably null
R5980:Olfr993 UTSW 2 85414165 missense probably damaging 1.00
R6139:Olfr993 UTSW 2 85414346 missense probably damaging 1.00
R6356:Olfr993 UTSW 2 85414687 missense probably damaging 1.00
R6619:Olfr993 UTSW 2 85414081 missense probably benign 0.05
R6672:Olfr993 UTSW 2 85414604 missense possibly damaging 0.87
R7326:Olfr993 UTSW 2 85414444 missense probably damaging 0.99
R7328:Olfr993 UTSW 2 85414324 missense probably benign 0.32
R7569:Olfr993 UTSW 2 85414135 missense probably damaging 1.00
R7924:Olfr993 UTSW 2 85414219 missense probably benign 0.06
Z1176:Olfr993 UTSW 2 85414663 missense probably damaging 1.00
Z1176:Olfr993 UTSW 2 85414685 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- CACAGAGGCCACTTTCATATTC -3'
(R):5'- CCCGAAAAGTCTGCATCCAG -3'

Sequencing Primer
(F):5'- AGAGGCCACTTTCATATTCTCCTCG -3'
(R):5'- CAGATGGTAGCTGGCTCCTATC -3'
Posted On2020-08-01