Incidental Mutation 'BB011:Plcb1'
ID 642613
Institutional Source Beutler Lab
Gene Symbol Plcb1
Ensembl Gene ENSMUSG00000051177
Gene Name phospholipase C, beta 1
Synonyms 3110043I21Rik
Accession Numbers
Essential gene? Probably non essential (E-score: 0.166) question?
Stock # BB011
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 134628084-135317178 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 135201613 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 855 (T855S)
Ref Sequence ENSEMBL: ENSMUSP00000105743 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070724] [ENSMUST00000110116] [ENSMUST00000131552]
AlphaFold Q9Z1B3
Predicted Effect probably benign
Transcript: ENSMUST00000070724
AA Change: T855S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000064844
Gene: ENSMUSG00000051177
AA Change: T855S

DomainStartEndE-ValueType
Pfam:EF-hand_like 224 315 2.2e-26 PFAM
PLCXc 316 467 2.85e-74 SMART
low complexity region 491 501 N/A INTRINSIC
PLCYc 540 656 2e-69 SMART
C2 677 776 1.55e-12 SMART
low complexity region 871 885 N/A INTRINSIC
Pfam:DUF1154 903 946 1.3e-7 PFAM
low complexity region 967 984 N/A INTRINSIC
Pfam:PLC-beta_C 997 1155 1.9e-64 PFAM
low complexity region 1157 1168 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110116
AA Change: T855S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000105743
Gene: ENSMUSG00000051177
AA Change: T855S

DomainStartEndE-ValueType
Pfam:EF-hand_like 224 315 4.1e-26 PFAM
PLCXc 316 467 2.85e-74 SMART
low complexity region 491 501 N/A INTRINSIC
PLCYc 540 656 2e-69 SMART
C2 677 776 1.55e-12 SMART
low complexity region 871 885 N/A INTRINSIC
Pfam:DUF1154 903 946 1.1e-9 PFAM
low complexity region 967 984 N/A INTRINSIC
Pfam:PLC-beta_C 1003 1176 2.9e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131552
AA Change: T855S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000118756
Gene: ENSMUSG00000051177
AA Change: T855S

DomainStartEndE-ValueType
Pfam:EF-hand_like 224 315 3.9e-26 PFAM
PLCXc 316 467 2.85e-74 SMART
low complexity region 491 501 N/A INTRINSIC
PLCYc 540 656 2e-69 SMART
C2 677 776 1.55e-12 SMART
low complexity region 871 885 N/A INTRINSIC
Pfam:DUF1154 903 946 1e-9 PFAM
low complexity region 967 984 N/A INTRINSIC
Pfam:PLC-beta_C 1003 1148 8e-51 PFAM
low complexity region 1157 1168 N/A INTRINSIC
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the formation of inositol 1,4,5-trisphosphate and diacylglycerol from phosphatidylinositol 4,5-bisphosphate. This reaction uses calcium as a cofactor and plays an important role in the intracellular transduction of many extracellular signals. This gene is activated by two G-protein alpha subunits, alpha-q and alpha-11. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit spontaneous seizures and high mortality around 3 weeks of age. Mutant males show exhibit sperm with a reduced acrosome reaction rate and fertilizing capacity in vitro and decreased fertility in vivo. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb A G 5: 114,383,281 (GRCm39) K2155E possibly damaging Het
Adgre5 G A 8: 84,456,029 (GRCm39) P256S possibly damaging Het
Adipor1 T A 1: 134,353,731 (GRCm39) V172D probably damaging Het
Ahsa1 T C 12: 87,317,230 (GRCm39) probably null Het
Ankrd11 T C 8: 123,622,641 (GRCm39) I404V possibly damaging Het
Asxl3 G A 18: 22,658,602 (GRCm39) R2204Q probably damaging Het
Barhl2 A G 5: 106,605,515 (GRCm39) S65P unknown Het
Bbx A T 16: 50,044,671 (GRCm39) L630H probably damaging Het
Cars1 T C 7: 143,123,608 (GRCm39) T531A possibly damaging Het
Catsperb T A 12: 101,486,824 (GRCm39) H450Q probably benign Het
Cdt1 T C 8: 123,296,091 (GRCm39) L135P probably damaging Het
Cfap206 T A 4: 34,728,833 (GRCm39) H24L probably benign Het
Cilk1 T C 9: 78,062,746 (GRCm39) L260P probably damaging Het
Cnga4 T A 7: 105,057,028 (GRCm39) V480E probably benign Het
Cnot1 ACG A 8: 96,472,275 (GRCm39) probably null Het
Ctcfl G A 2: 172,955,449 (GRCm39) T271I possibly damaging Het
Dlc1 T C 8: 37,038,570 (GRCm39) R1003G probably benign Het
Dnah7b A G 1: 46,258,590 (GRCm39) D1927G probably benign Het
Dscc1 A T 15: 54,945,572 (GRCm39) D374E probably benign Het
Eci2 G A 13: 35,177,053 (GRCm39) Q69* probably null Het
Ep300 C A 15: 81,533,703 (GRCm39) P1920Q unknown Het
Epha5 A G 5: 84,232,705 (GRCm39) Y629H possibly damaging Het
Fat2 G A 11: 55,153,613 (GRCm39) T3533I probably benign Het
Fat3 T C 9: 15,910,593 (GRCm39) N1803S probably damaging Het
Fcrl2 T C 3: 87,166,840 (GRCm39) Y51C probably damaging Het
G530012D18Rik C G 1: 85,504,935 (GRCm39) D113E unknown Het
Gcnt2 A T 13: 41,072,040 (GRCm39) K228* probably null Het
Gucy2c A T 6: 136,740,053 (GRCm39) V258E probably benign Het
Hecw1 C A 13: 14,497,113 (GRCm39) L298F probably damaging Het
Hydin T G 8: 111,145,103 (GRCm39) V818G possibly damaging Het
Hykk A G 9: 54,829,524 (GRCm39) Y131C probably damaging Het
Mpo A G 11: 87,685,666 (GRCm39) D48G probably damaging Het
Mrps10 T C 17: 47,689,208 (GRCm39) *202Q probably null Het
Mrps14 T C 1: 160,024,559 (GRCm39) V30A probably benign Het
Mtmr7 G A 8: 41,059,927 (GRCm39) A62V possibly damaging Het
Muc2 G T 7: 141,281,631 (GRCm39) G497W probably damaging Het
Nnt A T 13: 119,523,181 (GRCm39) V237D probably damaging Het
Nox4 G T 7: 87,023,589 (GRCm39) V492L probably benign Het
Obscn C G 11: 59,003,381 (GRCm39) E1306Q probably benign Het
Or5ak23 T C 2: 85,244,563 (GRCm39) Y220C probably benign Het
Or6aa1 A G 7: 86,043,938 (GRCm39) I256T probably damaging Het
Pard3 A G 8: 128,137,231 (GRCm39) N861S probably benign Het
Pdlim4 G A 11: 53,946,048 (GRCm39) R230* probably null Het
Pinlyp C T 7: 24,241,550 (GRCm39) V159M possibly damaging Het
Pot1a T A 6: 25,753,309 (GRCm39) D409V possibly damaging Het
Prom1 T C 5: 44,187,111 (GRCm39) D382G probably benign Het
Prss16 A T 13: 22,192,834 (GRCm39) N83K probably damaging Het
Ptprn2 A G 12: 116,804,884 (GRCm39) D133G probably benign Het
Rasef C T 4: 73,659,166 (GRCm39) probably null Het
Rbak A G 5: 143,160,241 (GRCm39) S271P probably damaging Het
Rbm20 A T 19: 53,666,016 (GRCm39) I60F possibly damaging Het
Rftn1 G T 17: 50,354,408 (GRCm39) A318D probably damaging Het
Rsf1 G GACGGCCGCC 7: 97,229,116 (GRCm39) probably benign Het
Serpinb3c A G 1: 107,200,904 (GRCm39) L171P probably damaging Het
Slc25a19 T C 11: 115,506,376 (GRCm39) Y211C unknown Het
Sorbs2 C T 8: 46,248,507 (GRCm39) S586L probably damaging Het
Spesp1 A T 9: 62,180,733 (GRCm39) S58R probably benign Het
Spryd3 A G 15: 102,026,762 (GRCm39) I329T probably benign Het
St8sia2 G A 7: 73,616,700 (GRCm39) L113F probably damaging Het
Star T C 8: 26,299,883 (GRCm39) I75T possibly damaging Het
Tasor2 A T 13: 3,644,331 (GRCm39) F129Y possibly damaging Het
Tdrd6 T A 17: 43,938,697 (GRCm39) I784F possibly damaging Het
Tex55 G A 16: 38,632,826 (GRCm39) Q369* probably null Het
Tsc22d4 A G 5: 137,766,273 (GRCm39) I144V unknown Het
Tspan8 T C 10: 115,669,229 (GRCm39) probably null Het
Ttll9 C T 2: 152,804,407 (GRCm39) probably benign Het
Ubr4 T G 4: 139,194,587 (GRCm39) L1160R unknown Het
Ufd1 A G 16: 18,642,035 (GRCm39) Y162C possibly damaging Het
Unc13c A T 9: 73,641,690 (GRCm39) F1268I probably benign Het
Uvssa T C 5: 33,568,295 (GRCm39) I561T probably damaging Het
Vmn2r15 A T 5: 109,434,254 (GRCm39) S817T probably damaging Het
Ybx1 T C 4: 119,139,476 (GRCm39) E173G probably damaging Het
Zc3h6 T C 2: 128,857,400 (GRCm39) S640P possibly damaging Het
Other mutations in Plcb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00510:Plcb1 APN 2 135,093,676 (GRCm39) missense possibly damaging 0.66
IGL01152:Plcb1 APN 2 134,655,579 (GRCm39) missense probably damaging 1.00
IGL01945:Plcb1 APN 2 135,062,711 (GRCm39) missense probably benign 0.03
IGL01999:Plcb1 APN 2 135,188,238 (GRCm39) missense probably damaging 1.00
IGL02109:Plcb1 APN 2 134,628,479 (GRCm39) missense probably damaging 1.00
IGL02153:Plcb1 APN 2 135,229,773 (GRCm39) missense probably benign 0.08
IGL02207:Plcb1 APN 2 135,229,091 (GRCm39) missense probably damaging 1.00
IGL02566:Plcb1 APN 2 135,314,183 (GRCm39) missense probably benign 0.17
IGL02590:Plcb1 APN 2 135,136,784 (GRCm39) missense probably benign 0.08
IGL02640:Plcb1 APN 2 135,062,779 (GRCm39) splice site probably benign
IGL02926:Plcb1 APN 2 135,206,682 (GRCm39) splice site probably benign
IGL03071:Plcb1 APN 2 135,229,722 (GRCm39) missense probably damaging 1.00
IGL03236:Plcb1 APN 2 135,188,226 (GRCm39) missense probably damaging 1.00
IGL03252:Plcb1 APN 2 135,212,348 (GRCm39) missense probably benign
IGL03387:Plcb1 APN 2 134,655,606 (GRCm39) splice site probably benign
BB001:Plcb1 UTSW 2 135,201,613 (GRCm39) missense probably benign 0.00
R0024:Plcb1 UTSW 2 135,204,345 (GRCm39) missense probably benign 0.06
R0024:Plcb1 UTSW 2 135,204,345 (GRCm39) missense probably benign 0.06
R0053:Plcb1 UTSW 2 135,136,835 (GRCm39) missense probably benign 0.33
R0053:Plcb1 UTSW 2 135,136,835 (GRCm39) missense probably benign 0.33
R0308:Plcb1 UTSW 2 134,655,534 (GRCm39) missense probably benign 0.01
R0415:Plcb1 UTSW 2 135,179,419 (GRCm39) missense probably damaging 1.00
R0624:Plcb1 UTSW 2 135,136,831 (GRCm39) missense possibly damaging 0.81
R0898:Plcb1 UTSW 2 135,229,063 (GRCm39) missense possibly damaging 0.73
R1071:Plcb1 UTSW 2 135,167,577 (GRCm39) missense possibly damaging 0.64
R1615:Plcb1 UTSW 2 135,204,364 (GRCm39) splice site probably benign
R1617:Plcb1 UTSW 2 135,179,361 (GRCm39) missense probably damaging 1.00
R1785:Plcb1 UTSW 2 135,167,587 (GRCm39) nonsense probably null
R1866:Plcb1 UTSW 2 135,186,093 (GRCm39) missense probably benign 0.01
R1869:Plcb1 UTSW 2 135,152,934 (GRCm39) missense probably benign 0.02
R1902:Plcb1 UTSW 2 134,655,533 (GRCm39) missense possibly damaging 0.93
R1938:Plcb1 UTSW 2 135,228,222 (GRCm39) missense probably damaging 1.00
R2016:Plcb1 UTSW 2 135,204,340 (GRCm39) missense possibly damaging 0.94
R2017:Plcb1 UTSW 2 135,204,340 (GRCm39) missense possibly damaging 0.94
R2131:Plcb1 UTSW 2 135,167,587 (GRCm39) nonsense probably null
R2132:Plcb1 UTSW 2 135,167,587 (GRCm39) nonsense probably null
R2133:Plcb1 UTSW 2 135,167,587 (GRCm39) nonsense probably null
R2164:Plcb1 UTSW 2 135,188,250 (GRCm39) missense possibly damaging 0.87
R2419:Plcb1 UTSW 2 135,104,020 (GRCm39) splice site probably benign
R2429:Plcb1 UTSW 2 135,179,362 (GRCm39) missense probably damaging 0.99
R2508:Plcb1 UTSW 2 135,102,428 (GRCm39) missense probably benign 0.27
R3161:Plcb1 UTSW 2 135,177,402 (GRCm39) missense probably benign 0.03
R3870:Plcb1 UTSW 2 135,167,591 (GRCm39) missense probably damaging 0.99
R4191:Plcb1 UTSW 2 135,187,010 (GRCm39) missense probably damaging 1.00
R4239:Plcb1 UTSW 2 135,186,078 (GRCm39) missense probably damaging 0.99
R4552:Plcb1 UTSW 2 135,177,413 (GRCm39) missense probably benign 0.44
R4553:Plcb1 UTSW 2 135,177,413 (GRCm39) missense probably benign 0.44
R4720:Plcb1 UTSW 2 135,093,667 (GRCm39) missense possibly damaging 0.70
R4946:Plcb1 UTSW 2 135,187,015 (GRCm39) missense probably benign 0.01
R5012:Plcb1 UTSW 2 135,175,320 (GRCm39) missense probably null 0.97
R5151:Plcb1 UTSW 2 135,104,165 (GRCm39) missense probably benign 0.28
R5320:Plcb1 UTSW 2 135,094,696 (GRCm39) missense possibly damaging 0.56
R5415:Plcb1 UTSW 2 135,189,322 (GRCm39) missense possibly damaging 0.67
R5523:Plcb1 UTSW 2 135,102,486 (GRCm39) missense probably benign 0.08
R5568:Plcb1 UTSW 2 135,212,513 (GRCm39) missense probably damaging 1.00
R5688:Plcb1 UTSW 2 135,177,400 (GRCm39) missense probably benign 0.06
R5809:Plcb1 UTSW 2 135,104,164 (GRCm39) missense possibly damaging 0.83
R6237:Plcb1 UTSW 2 135,212,486 (GRCm39) missense possibly damaging 0.94
R6315:Plcb1 UTSW 2 135,188,261 (GRCm39) missense probably benign 0.00
R6478:Plcb1 UTSW 2 135,177,371 (GRCm39) missense probably damaging 1.00
R6531:Plcb1 UTSW 2 135,167,722 (GRCm39) critical splice donor site probably null
R6683:Plcb1 UTSW 2 134,628,513 (GRCm39) missense probably benign 0.32
R6760:Plcb1 UTSW 2 135,313,980 (GRCm39) missense possibly damaging 0.50
R6947:Plcb1 UTSW 2 135,228,075 (GRCm39) missense probably benign 0.08
R6976:Plcb1 UTSW 2 135,104,159 (GRCm39) missense possibly damaging 0.75
R7379:Plcb1 UTSW 2 135,212,430 (GRCm39) missense probably benign 0.45
R7473:Plcb1 UTSW 2 135,186,196 (GRCm39) missense probably damaging 0.98
R7492:Plcb1 UTSW 2 135,093,684 (GRCm39) nonsense probably null
R7498:Plcb1 UTSW 2 135,104,154 (GRCm39) missense probably damaging 0.99
R7498:Plcb1 UTSW 2 135,104,153 (GRCm39) nonsense probably null
R7777:Plcb1 UTSW 2 135,062,677 (GRCm39) missense possibly damaging 0.51
R7924:Plcb1 UTSW 2 135,201,613 (GRCm39) missense probably benign 0.00
R8061:Plcb1 UTSW 2 135,188,316 (GRCm39) missense probably benign
R8099:Plcb1 UTSW 2 135,093,654 (GRCm39) missense possibly damaging 0.68
R8299:Plcb1 UTSW 2 135,177,396 (GRCm39) missense probably damaging 1.00
R8394:Plcb1 UTSW 2 135,159,710 (GRCm39) missense probably damaging 1.00
R8439:Plcb1 UTSW 2 135,091,972 (GRCm39) critical splice donor site probably null
R8549:Plcb1 UTSW 2 135,206,853 (GRCm39) missense probably benign 0.00
R8693:Plcb1 UTSW 2 135,094,696 (GRCm39) missense probably benign 0.00
R8750:Plcb1 UTSW 2 135,177,369 (GRCm39) missense probably damaging 1.00
R8817:Plcb1 UTSW 2 135,175,429 (GRCm39) intron probably benign
R8950:Plcb1 UTSW 2 135,179,439 (GRCm39) missense probably damaging 1.00
R9146:Plcb1 UTSW 2 135,182,615 (GRCm39) missense probably damaging 1.00
R9301:Plcb1 UTSW 2 135,167,610 (GRCm39) missense possibly damaging 0.96
R9311:Plcb1 UTSW 2 135,189,385 (GRCm39) missense probably benign 0.00
R9459:Plcb1 UTSW 2 135,164,558 (GRCm39) missense probably benign 0.03
S24628:Plcb1 UTSW 2 135,179,419 (GRCm39) missense probably damaging 1.00
X0025:Plcb1 UTSW 2 135,186,974 (GRCm39) missense possibly damaging 0.87
Z1088:Plcb1 UTSW 2 135,062,766 (GRCm39) missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GCTGAGTTAATCTTGCTTTCTTGAC -3'
(R):5'- CAACCATGTGTCCATCCTGC -3'

Sequencing Primer
(F):5'- GCTTTCTTGACAGTTTCAAATTTGG -3'
(R):5'- AGTCTGCTTATATCCCTCAGCCATAG -3'
Posted On 2020-08-01