Mutagenetix > Incidental Mutations

Incidental Mutation 'BB011:Ctcfl'

642615

Institutional Source

Beutler Lab

Gene Symbol

Ctcfl

Ensembl Gene

ENSMUSG00000070495

Gene Name

CCCTC-binding factor (zinc finger protein)-like

Synonyms

Boris, OTTMUSG00000016680

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.417) question?

Stock #

BB011

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

173093609-173119525 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 173113656 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 271 (T271I)

Ref Sequence

ENSEMBL: ENSMUSP00000091845 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094287] [ENSMUST00000179693]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000094287
AA Change: T271I

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000091845
Gene: ENSMUSG00000070495
AA Change: T271I

Domain	Start	End	E-Value	Type
low complexity region	194	202	N/A	INTRINSIC
ZnF_C2H2	257	279	1.79e-2	SMART
ZnF_C2H2	285	307	1.07e0	SMART
ZnF_C2H2	313	336	4.47e-3	SMART
ZnF_C2H2	342	364	1.79e-2	SMART
ZnF_C2H2	370	392	5.81e-2	SMART
ZnF_C2H2	398	421	1.36e-2	SMART
ZnF_C2H2	428	451	6.23e-2	SMART
ZnF_C2H2	458	480	1.89e-1	SMART
ZnF_C2H2	486	508	8.94e-3	SMART
ZnF_C2H2	514	537	2.32e-1	SMART
ZnF_C2H2	546	572	5.2e0	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000179693
AA Change: T271I

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000135932
Gene: ENSMUSG00000070495
AA Change: T271I

Domain	Start	End	E-Value	Type
low complexity region	194	202	N/A	INTRINSIC
ZnF_C2H2	257	279	1.79e-2	SMART
ZnF_C2H2	285	307	1.07e0	SMART
ZnF_C2H2	313	336	4.47e-3	SMART
ZnF_C2H2	342	364	1.79e-2	SMART
ZnF_C2H2	370	392	5.81e-2	SMART
ZnF_C2H2	398	421	1.36e-2	SMART
ZnF_C2H2	428	451	6.23e-2	SMART
ZnF_C2H2	458	480	1.89e-1	SMART
ZnF_C2H2	486	508	8.94e-3	SMART
ZnF_C2H2	514	537	2.32e-1	SMART
ZnF_C2H2	546	572	5.2e0	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CCCTC-binding factor (CTCF), an 11-zinc-finger factor involved in gene regulation, utilizes different zinc fingers to bind varying DNA target sites. CTCF forms methylation-sensitive insulators that regulate X-chromosome inactivation. This gene is a paralog of CTCF and appears to be expressed primarily in the cytoplasm of spermatocytes, unlike CTCF which is expressed primarily in the nucleus of somatic cells. CTCF and the protein encoded by this gene are normally expressed in a mutually exclusive pattern that correlates with resetting of methylation marks during male germ cell differentiation. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit small testes, delayed spermatid development, and increased male germ cell apoptosis without affecting fertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930435E12Rik	G	A	16: 38,812,464	Q369*	probably null	Het
Acacb	A	G	5: 114,245,220	K2155E	possibly damaging	Het
Adgre5	G	A	8: 83,729,400	P256S	possibly damaging	Het
Adipor1	T	A	1: 134,425,993	V172D	probably damaging	Het
Ahsa1	T	C	12: 87,270,456		probably null	Het
Ankrd11	T	C	8: 122,895,902	I404V	possibly damaging	Het
Asxl3	G	A	18: 22,525,545	R2204Q	probably damaging	Het
Barhl2	A	G	5: 106,457,649	S65P	unknown	Het
Bbx	A	T	16: 50,224,308	L630H	probably damaging	Het
Cars	T	C	7: 143,569,871	T531A	possibly damaging	Het
Catsperb	T	A	12: 101,520,565	H450Q	probably benign	Het
Cdt1	T	C	8: 122,569,352	L135P	probably damaging	Het
Cfap206	T	A	4: 34,728,833	H24L	probably benign	Het
Cnga4	T	A	7: 105,407,821	V480E	probably benign	Het
Cnot1	ACG	A	8: 95,745,647		probably null	Het
Dlc1	T	C	8: 36,571,416	R1003G	probably benign	Het
Dnah7b	A	G	1: 46,219,430	D1927G	probably benign	Het
Dscc1	A	T	15: 55,082,176	D374E	probably benign	Het
Eci2	G	A	13: 34,993,070	Q69*	probably null	Het
Ep300	C	A	15: 81,649,502	P1920Q	unknown	Het
Epha5	A	G	5: 84,084,846	Y629H	possibly damaging	Het
Fam208b	A	T	13: 3,594,331	F129Y	possibly damaging	Het
Fat2	G	A	11: 55,262,787	T3533I	probably benign	Het
Fat3	T	C	9: 15,999,297	N1803S	probably damaging	Het
Fcrls	T	C	3: 87,259,533	Y51C	probably damaging	Het
G530012D18Rik	C	G	1: 85,577,214	D113E	unknown	Het
Gcnt2	A	T	13: 40,918,564	K228*	probably null	Het
Gucy2c	A	T	6: 136,763,055	V258E	probably benign	Het
Hecw1	C	A	13: 14,322,528	L298F	probably damaging	Het
Hydin	T	G	8: 110,418,471	V818G	possibly damaging	Het
Hykk	A	G	9: 54,922,240	Y131C	probably damaging	Het
Ick	T	C	9: 78,155,464	L260P	probably damaging	Het
Mpo	A	G	11: 87,794,840	D48G	probably damaging	Het
Mrps10	T	C	17: 47,378,283	*202Q	probably null	Het
Mrps14	T	C	1: 160,196,989	V30A	probably benign	Het
Mtmr7	G	A	8: 40,606,884	A62V	possibly damaging	Het
Muc2	G	T	7: 141,695,388	G497W	probably damaging	Het
Nnt	A	T	13: 119,386,645	V237D	probably damaging	Het
Nox4	G	T	7: 87,374,381	V492L	probably benign	Het
Obscn	C	G	11: 59,112,555	E1306Q	probably benign	Het
Olfr303	A	G	7: 86,394,730	I256T	probably damaging	Het
Olfr993	T	C	2: 85,414,219	Y220C	probably benign	Het
Pard3	A	G	8: 127,410,750	N861S	probably benign	Het
Pdlim4	G	A	11: 54,055,222	R230*	probably null	Het
Pinlyp	C	T	7: 24,542,125	V159M	possibly damaging	Het
Plcb1	A	T	2: 135,359,693	T855S	probably benign	Het
Pot1a	T	A	6: 25,753,310	D409V	possibly damaging	Het
Prom1	T	C	5: 44,029,769	D382G	probably benign	Het
Prss16	A	T	13: 22,008,664	N83K	probably damaging	Het
Ptprn2	A	G	12: 116,841,264	D133G	probably benign	Het
Rasef	C	T	4: 73,740,929		probably null	Het
Rbak	A	G	5: 143,174,486	S271P	probably damaging	Het
Rbm20	A	T	19: 53,677,585	I60F	possibly damaging	Het
Rftn1	G	T	17: 50,047,380	A318D	probably damaging	Het
Rsf1	G	GACGGCCGCC	7: 97,579,909		probably benign	Het
Serpinb3c	A	G	1: 107,273,174	L171P	probably damaging	Het
Slc25a19	T	C	11: 115,615,550	Y211C	unknown	Het
Sorbs2	C	T	8: 45,795,470	S586L	probably damaging	Het
Spesp1	A	T	9: 62,273,451	S58R	probably benign	Het
Spryd3	A	G	15: 102,118,327	I329T	probably benign	Het
St8sia2	G	A	7: 73,966,952	L113F	probably damaging	Het
Star	T	C	8: 25,809,855	I75T	possibly damaging	Het
Tdrd6	T	A	17: 43,627,806	I784F	possibly damaging	Het
Tsc22d4	A	G	5: 137,768,011	I144V	unknown	Het
Tspan8	T	C	10: 115,833,324		probably null	Het
Ttll9	C	T	2: 152,962,487		probably benign	Het
Ubr4	T	G	4: 139,467,276	L1160R	unknown	Het
Ufd1	A	G	16: 18,823,285	Y162C	possibly damaging	Het
Unc13c	A	T	9: 73,734,408	F1268I	probably benign	Het
Uvssa	T	C	5: 33,410,951	I561T	probably damaging	Het
Vmn2r15	A	T	5: 109,286,388	S817T	probably damaging	Het
Ybx1	T	C	4: 119,282,279	E173G	probably damaging	Het
Zc3h6	T	C	2: 129,015,480	S640P	possibly damaging	Het

Other mutations in Ctcfl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01344:Ctcfl	APN	2	173094734	missense	possibly damaging	0.82
IGL01418:Ctcfl	APN	2	173118331	missense	probably benign	0.03
IGL01524:Ctcfl	APN	2	173117384	missense	probably benign	0.08
IGL02610:Ctcfl	APN	2	173106026	splice site	probably benign
IGL02961:Ctcfl	APN	2	173101919	missense	possibly damaging	0.70
BB001:Ctcfl	UTSW	2	173113656	missense	possibly damaging	0.71
R0147:Ctcfl	UTSW	2	173118547	missense	possibly damaging	0.75
R0148:Ctcfl	UTSW	2	173118547	missense	possibly damaging	0.75
R0362:Ctcfl	UTSW	2	173118443	missense	probably damaging	0.99
R1099:Ctcfl	UTSW	2	173112360	missense	probably damaging	1.00
R1540:Ctcfl	UTSW	2	173112348	missense	probably benign	0.36
R1892:Ctcfl	UTSW	2	173118685	missense	probably benign	0.24
R2036:Ctcfl	UTSW	2	173101985	missense	possibly damaging	0.95
R2060:Ctcfl	UTSW	2	173118506	missense	probably benign	0.00
R2925:Ctcfl	UTSW	2	173094696	missense	probably damaging	1.00
R4327:Ctcfl	UTSW	2	173113506	intron	probably benign
R4837:Ctcfl	UTSW	2	173113656	missense	probably benign	0.00
R4894:Ctcfl	UTSW	2	173117403	missense	probably benign	0.19
R4909:Ctcfl	UTSW	2	173095398	missense	probably benign	0.42
R5128:Ctcfl	UTSW	2	173117396	missense	probably benign	0.00
R5247:Ctcfl	UTSW	2	173113609	missense	probably damaging	1.00
R6263:Ctcfl	UTSW	2	173095337	missense	probably benign	0.00
R6768:Ctcfl	UTSW	2	173117291	missense	possibly damaging	0.84
R7045:Ctcfl	UTSW	2	173112374	missense	probably damaging	1.00
R7180:Ctcfl	UTSW	2	173105977	splice site	probably null
R7256:Ctcfl	UTSW	2	173118475	missense	probably benign	0.01
R7268:Ctcfl	UTSW	2	173107795	missense	probably benign	0.26
R7378:Ctcfl	UTSW	2	173112258	missense	probably damaging	1.00
R7560:Ctcfl	UTSW	2	173118406	missense	probably damaging	0.96
R7657:Ctcfl	UTSW	2	173113656	missense	possibly damaging	0.71
R7733:Ctcfl	UTSW	2	173117192	missense	probably benign
R7924:Ctcfl	UTSW	2	173113656	missense	possibly damaging	0.71
R7945:Ctcfl	UTSW	2	173118658	missense	probably benign
R8022:Ctcfl	UTSW	2	173118766	missense	probably benign	0.15
R8038:Ctcfl	UTSW	2	173101905	missense	probably damaging	1.00
Z1088:Ctcfl	UTSW	2	173118344	missense	probably benign	0.01
Z1177:Ctcfl	UTSW	2	173102036	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TTTTCTCCAGACAGTGAAGCC -3'
(R):5'- TCCCGAGGTTTTGAGACATC -3'

Sequencing Primer
(F):5'- ACAGTGAAGCCCCAGGTG -3'
(R):5'- GAGACATCTCATAATCCTCAACAGC -3'

Posted On

2020-08-01