Mutagenetix > Incidental Mutation

Incidental Mutation 'BB011:Rasef'

642618

Institutional Source

Beutler Lab

Gene Symbol

Rasef

Ensembl Gene

ENSMUSG00000043003

Gene Name

RAS and EF hand domain containing

Synonyms

RAB45

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.079) question?

Stock #

BB011

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

73714579-73790994 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (1 bp from exon)

DNA Base Change (assembly)

C to T at 73740929 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000062771 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000058292] [ENSMUST00000102837] [ENSMUST00000222414]

AlphaFold

Q5RI75

Predicted Effect

probably null
Transcript: ENSMUST00000058292

SMART Domains

Protein: ENSMUSP00000062771
Gene: ENSMUSG00000043003

Domain	Start	End	E-Value	Type
low complexity region	20	34	N/A	INTRINSIC
coiled coil region	55	251	N/A	INTRINSIC
RAB	429	598	4.94e-69	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000102837

SMART Domains

Protein: ENSMUSP00000099901
Gene: ENSMUSG00000043003

Domain	Start	End	E-Value	Type
coiled coil region	5	179	N/A	INTRINSIC
RAB	357	526	4.94e-69	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000222414

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Rab family of GTPases that are involved in regulation of membrane traffic. The encoded protein contains an N-terminal EF-hand domain, a coiled-coil motif and a C-terminal Rab domain. A potential role as tumor suppressor has been indicated for this gene. [provided by RefSeq, Nov 2012]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930435E12Rik	G	A	16: 38,812,464	Q369*	probably null	Het
Acacb	A	G	5: 114,245,220	K2155E	possibly damaging	Het
Adgre5	G	A	8: 83,729,400	P256S	possibly damaging	Het
Adipor1	T	A	1: 134,425,993	V172D	probably damaging	Het
Ahsa1	T	C	12: 87,270,456		probably null	Het
Ankrd11	T	C	8: 122,895,902	I404V	possibly damaging	Het
Asxl3	G	A	18: 22,525,545	R2204Q	probably damaging	Het
Barhl2	A	G	5: 106,457,649	S65P	unknown	Het
Bbx	A	T	16: 50,224,308	L630H	probably damaging	Het
Cars	T	C	7: 143,569,871	T531A	possibly damaging	Het
Catsperb	T	A	12: 101,520,565	H450Q	probably benign	Het
Cdt1	T	C	8: 122,569,352	L135P	probably damaging	Het
Cfap206	T	A	4: 34,728,833	H24L	probably benign	Het
Cnga4	T	A	7: 105,407,821	V480E	probably benign	Het
Cnot1	ACG	A	8: 95,745,647		probably null	Het
Ctcfl	G	A	2: 173,113,656	T271I	possibly damaging	Het
Dlc1	T	C	8: 36,571,416	R1003G	probably benign	Het
Dnah7b	A	G	1: 46,219,430	D1927G	probably benign	Het
Dscc1	A	T	15: 55,082,176	D374E	probably benign	Het
Eci2	G	A	13: 34,993,070	Q69*	probably null	Het
Ep300	C	A	15: 81,649,502	P1920Q	unknown	Het
Epha5	A	G	5: 84,084,846	Y629H	possibly damaging	Het
Fam208b	A	T	13: 3,594,331	F129Y	possibly damaging	Het
Fat2	G	A	11: 55,262,787	T3533I	probably benign	Het
Fat3	T	C	9: 15,999,297	N1803S	probably damaging	Het
Fcrls	T	C	3: 87,259,533	Y51C	probably damaging	Het
G530012D18Rik	C	G	1: 85,577,214	D113E	unknown	Het
Gcnt2	A	T	13: 40,918,564	K228*	probably null	Het
Gucy2c	A	T	6: 136,763,055	V258E	probably benign	Het
Hecw1	C	A	13: 14,322,528	L298F	probably damaging	Het
Hydin	T	G	8: 110,418,471	V818G	possibly damaging	Het
Hykk	A	G	9: 54,922,240	Y131C	probably damaging	Het
Ick	T	C	9: 78,155,464	L260P	probably damaging	Het
Mpo	A	G	11: 87,794,840	D48G	probably damaging	Het
Mrps10	T	C	17: 47,378,283	*202Q	probably null	Het
Mrps14	T	C	1: 160,196,989	V30A	probably benign	Het
Mtmr7	G	A	8: 40,606,884	A62V	possibly damaging	Het
Muc2	G	T	7: 141,695,388	G497W	probably damaging	Het
Nnt	A	T	13: 119,386,645	V237D	probably damaging	Het
Nox4	G	T	7: 87,374,381	V492L	probably benign	Het
Obscn	C	G	11: 59,112,555	E1306Q	probably benign	Het
Olfr303	A	G	7: 86,394,730	I256T	probably damaging	Het
Olfr993	T	C	2: 85,414,219	Y220C	probably benign	Het
Pard3	A	G	8: 127,410,750	N861S	probably benign	Het
Pdlim4	G	A	11: 54,055,222	R230*	probably null	Het
Pinlyp	C	T	7: 24,542,125	V159M	possibly damaging	Het
Plcb1	A	T	2: 135,359,693	T855S	probably benign	Het
Pot1a	T	A	6: 25,753,310	D409V	possibly damaging	Het
Prom1	T	C	5: 44,029,769	D382G	probably benign	Het
Prss16	A	T	13: 22,008,664	N83K	probably damaging	Het
Ptprn2	A	G	12: 116,841,264	D133G	probably benign	Het
Rbak	A	G	5: 143,174,486	S271P	probably damaging	Het
Rbm20	A	T	19: 53,677,585	I60F	possibly damaging	Het
Rftn1	G	T	17: 50,047,380	A318D	probably damaging	Het
Rsf1	G	GACGGCCGCC	7: 97,579,909		probably benign	Het
Serpinb3c	A	G	1: 107,273,174	L171P	probably damaging	Het
Slc25a19	T	C	11: 115,615,550	Y211C	unknown	Het
Sorbs2	C	T	8: 45,795,470	S586L	probably damaging	Het
Spesp1	A	T	9: 62,273,451	S58R	probably benign	Het
Spryd3	A	G	15: 102,118,327	I329T	probably benign	Het
St8sia2	G	A	7: 73,966,952	L113F	probably damaging	Het
Star	T	C	8: 25,809,855	I75T	possibly damaging	Het
Tdrd6	T	A	17: 43,627,806	I784F	possibly damaging	Het
Tsc22d4	A	G	5: 137,768,011	I144V	unknown	Het
Tspan8	T	C	10: 115,833,324		probably null	Het
Ttll9	C	T	2: 152,962,487		probably benign	Het
Ubr4	T	G	4: 139,467,276	L1160R	unknown	Het
Ufd1	A	G	16: 18,823,285	Y162C	possibly damaging	Het
Unc13c	A	T	9: 73,734,408	F1268I	probably benign	Het
Uvssa	T	C	5: 33,410,951	I561T	probably damaging	Het
Vmn2r15	A	T	5: 109,286,388	S817T	probably damaging	Het
Ybx1	T	C	4: 119,282,279	E173G	probably damaging	Het
Zc3h6	T	C	2: 129,015,480	S640P	possibly damaging	Het

Other mutations in Rasef

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00430:Rasef	APN	4	73771425	nonsense	probably null
IGL01329:Rasef	APN	4	73727645	missense	probably damaging	1.00
IGL01517:Rasef	APN	4	73769822	missense	probably benign	0.03
IGL02465:Rasef	APN	4	73734488	missense	probably damaging	1.00
IGL02676:Rasef	APN	4	73759729	missense	possibly damaging	0.69
IGL03137:Rasef	APN	4	73734483	nonsense	probably null
IGL03403:Rasef	APN	4	73734534	missense	probably damaging	1.00
BB001:Rasef	UTSW	4	73740929	critical splice donor site	probably null
P0033:Rasef	UTSW	4	73749852	missense	probably benign	0.26
R0035:Rasef	UTSW	4	73762854	splice site	probably benign
R0035:Rasef	UTSW	4	73762854	splice site	probably benign
R0317:Rasef	UTSW	4	73748562	missense	probably damaging	1.00
R0686:Rasef	UTSW	4	73734534	missense	probably damaging	1.00
R0987:Rasef	UTSW	4	73734484	nonsense	probably null
R1115:Rasef	UTSW	4	73748604	missense	possibly damaging	0.85
R1511:Rasef	UTSW	4	73735748	missense	probably damaging	1.00
R1585:Rasef	UTSW	4	73740337	missense	probably damaging	1.00
R1646:Rasef	UTSW	4	73734549	missense	probably damaging	1.00
R1705:Rasef	UTSW	4	73744064	nonsense	probably null
R1918:Rasef	UTSW	4	73744114	missense	possibly damaging	0.94
R1919:Rasef	UTSW	4	73744114	missense	possibly damaging	0.94
R3819:Rasef	UTSW	4	73759705	missense	probably damaging	1.00
R3891:Rasef	UTSW	4	73780397	missense	probably benign	0.03
R3892:Rasef	UTSW	4	73780397	missense	probably benign	0.03
R4344:Rasef	UTSW	4	73745089	missense	probably damaging	1.00
R4491:Rasef	UTSW	4	73734503	missense	probably damaging	1.00
R4492:Rasef	UTSW	4	73734503	missense	probably damaging	1.00
R4594:Rasef	UTSW	4	73780389	missense	possibly damaging	0.47
R4915:Rasef	UTSW	4	73731459	missense	probably damaging	1.00
R5276:Rasef	UTSW	4	73735767	missense	probably null	1.00
R5359:Rasef	UTSW	4	73771328	missense	probably damaging	1.00
R5682:Rasef	UTSW	4	73740971	nonsense	probably null
R5693:Rasef	UTSW	4	73769839	missense	probably damaging	0.99
R6414:Rasef	UTSW	4	73740581	missense	probably benign	0.13
R6543:Rasef	UTSW	4	73780519	intron	probably benign
R6593:Rasef	UTSW	4	73745090	missense	probably damaging	1.00
R7078:Rasef	UTSW	4	73780389	missense	probably benign	0.01
R7083:Rasef	UTSW	4	73790984	missense	probably benign	0.26
R7106:Rasef	UTSW	4	73727627	missense	probably damaging	1.00
R7127:Rasef	UTSW	4	73744132	missense	probably damaging	1.00
R7329:Rasef	UTSW	4	73744137	missense	probably damaging	1.00
R7767:Rasef	UTSW	4	73734534	missense	probably damaging	1.00
R7891:Rasef	UTSW	4	73759698	missense	probably benign	0.00
R7891:Rasef	UTSW	4	73790964	missense	probably benign
R7924:Rasef	UTSW	4	73740929	critical splice donor site	probably null
R7997:Rasef	UTSW	4	73740562	missense	possibly damaging	0.78
R8554:Rasef	UTSW	4	73727607	missense	probably benign	0.03
R8832:Rasef	UTSW	4	73780321	intron	probably benign
R8850:Rasef	UTSW	4	73727603	missense	probably damaging	1.00
R8985:Rasef	UTSW	4	73790723	missense	possibly damaging	0.48
R9093:Rasef	UTSW	4	73780346	missense	probably benign	0.00
R9179:Rasef	UTSW	4	73744119	missense	probably damaging	0.97
R9199:Rasef	UTSW	4	73740388	missense	possibly damaging	0.88
R9300:Rasef	UTSW	4	73741156	missense	probably benign
R9310:Rasef	UTSW	4	73735719	critical splice donor site	probably null
R9415:Rasef	UTSW	4	73727645	missense	probably benign	0.00
R9482:Rasef	UTSW	4	73790696	missense	probably benign	0.00
R9719:Rasef	UTSW	4	73769865	missense	possibly damaging	0.62

Predicted Primers

PCR Primer
(F):5'- TGTACTGCCAGTGTGGTTACTAAG -3'
(R):5'- TCTGTGACCCTCTGCAGAAG -3'

Sequencing Primer
(F):5'- GTGTGGTTACTAAGCAGACTCCC -3'
(R):5'- GACCCTCTGCAGAAGATGAATTATG -3'

Posted On

2020-08-01