Incidental Mutation 'BB011:Rasef'
ID 642618
Institutional Source Beutler Lab
Gene Symbol Rasef
Ensembl Gene ENSMUSG00000043003
Gene Name RAS and EF hand domain containing
Synonyms RAB45
Accession Numbers
Essential gene? Probably non essential (E-score: 0.079) question?
Stock # BB011
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 73714579-73790994 bp(-) (GRCm38)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 73740929 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000062771 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058292] [ENSMUST00000102837] [ENSMUST00000222414]
AlphaFold Q5RI75
Predicted Effect probably null
Transcript: ENSMUST00000058292
SMART Domains Protein: ENSMUSP00000062771
Gene: ENSMUSG00000043003

DomainStartEndE-ValueType
low complexity region 20 34 N/A INTRINSIC
coiled coil region 55 251 N/A INTRINSIC
RAB 429 598 4.94e-69 SMART
Predicted Effect probably null
Transcript: ENSMUST00000102837
SMART Domains Protein: ENSMUSP00000099901
Gene: ENSMUSG00000043003

DomainStartEndE-ValueType
coiled coil region 5 179 N/A INTRINSIC
RAB 357 526 4.94e-69 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000222414
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Rab family of GTPases that are involved in regulation of membrane traffic. The encoded protein contains an N-terminal EF-hand domain, a coiled-coil motif and a C-terminal Rab domain. A potential role as tumor suppressor has been indicated for this gene. [provided by RefSeq, Nov 2012]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930435E12Rik G A 16: 38,812,464 Q369* probably null Het
Acacb A G 5: 114,245,220 K2155E possibly damaging Het
Adgre5 G A 8: 83,729,400 P256S possibly damaging Het
Adipor1 T A 1: 134,425,993 V172D probably damaging Het
Ahsa1 T C 12: 87,270,456 probably null Het
Ankrd11 T C 8: 122,895,902 I404V possibly damaging Het
Asxl3 G A 18: 22,525,545 R2204Q probably damaging Het
Barhl2 A G 5: 106,457,649 S65P unknown Het
Bbx A T 16: 50,224,308 L630H probably damaging Het
Cars T C 7: 143,569,871 T531A possibly damaging Het
Catsperb T A 12: 101,520,565 H450Q probably benign Het
Cdt1 T C 8: 122,569,352 L135P probably damaging Het
Cfap206 T A 4: 34,728,833 H24L probably benign Het
Cnga4 T A 7: 105,407,821 V480E probably benign Het
Cnot1 ACG A 8: 95,745,647 probably null Het
Ctcfl G A 2: 173,113,656 T271I possibly damaging Het
Dlc1 T C 8: 36,571,416 R1003G probably benign Het
Dnah7b A G 1: 46,219,430 D1927G probably benign Het
Dscc1 A T 15: 55,082,176 D374E probably benign Het
Eci2 G A 13: 34,993,070 Q69* probably null Het
Ep300 C A 15: 81,649,502 P1920Q unknown Het
Epha5 A G 5: 84,084,846 Y629H possibly damaging Het
Fam208b A T 13: 3,594,331 F129Y possibly damaging Het
Fat2 G A 11: 55,262,787 T3533I probably benign Het
Fat3 T C 9: 15,999,297 N1803S probably damaging Het
Fcrls T C 3: 87,259,533 Y51C probably damaging Het
G530012D18Rik C G 1: 85,577,214 D113E unknown Het
Gcnt2 A T 13: 40,918,564 K228* probably null Het
Gucy2c A T 6: 136,763,055 V258E probably benign Het
Hecw1 C A 13: 14,322,528 L298F probably damaging Het
Hydin T G 8: 110,418,471 V818G possibly damaging Het
Hykk A G 9: 54,922,240 Y131C probably damaging Het
Ick T C 9: 78,155,464 L260P probably damaging Het
Mpo A G 11: 87,794,840 D48G probably damaging Het
Mrps10 T C 17: 47,378,283 *202Q probably null Het
Mrps14 T C 1: 160,196,989 V30A probably benign Het
Mtmr7 G A 8: 40,606,884 A62V possibly damaging Het
Muc2 G T 7: 141,695,388 G497W probably damaging Het
Nnt A T 13: 119,386,645 V237D probably damaging Het
Nox4 G T 7: 87,374,381 V492L probably benign Het
Obscn C G 11: 59,112,555 E1306Q probably benign Het
Olfr303 A G 7: 86,394,730 I256T probably damaging Het
Olfr993 T C 2: 85,414,219 Y220C probably benign Het
Pard3 A G 8: 127,410,750 N861S probably benign Het
Pdlim4 G A 11: 54,055,222 R230* probably null Het
Pinlyp C T 7: 24,542,125 V159M possibly damaging Het
Plcb1 A T 2: 135,359,693 T855S probably benign Het
Pot1a T A 6: 25,753,310 D409V possibly damaging Het
Prom1 T C 5: 44,029,769 D382G probably benign Het
Prss16 A T 13: 22,008,664 N83K probably damaging Het
Ptprn2 A G 12: 116,841,264 D133G probably benign Het
Rbak A G 5: 143,174,486 S271P probably damaging Het
Rbm20 A T 19: 53,677,585 I60F possibly damaging Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Rsf1 G GACGGCCGCC 7: 97,579,909 probably benign Het
Serpinb3c A G 1: 107,273,174 L171P probably damaging Het
Slc25a19 T C 11: 115,615,550 Y211C unknown Het
Sorbs2 C T 8: 45,795,470 S586L probably damaging Het
Spesp1 A T 9: 62,273,451 S58R probably benign Het
Spryd3 A G 15: 102,118,327 I329T probably benign Het
St8sia2 G A 7: 73,966,952 L113F probably damaging Het
Star T C 8: 25,809,855 I75T possibly damaging Het
Tdrd6 T A 17: 43,627,806 I784F possibly damaging Het
Tsc22d4 A G 5: 137,768,011 I144V unknown Het
Tspan8 T C 10: 115,833,324 probably null Het
Ttll9 C T 2: 152,962,487 probably benign Het
Ubr4 T G 4: 139,467,276 L1160R unknown Het
Ufd1 A G 16: 18,823,285 Y162C possibly damaging Het
Unc13c A T 9: 73,734,408 F1268I probably benign Het
Uvssa T C 5: 33,410,951 I561T probably damaging Het
Vmn2r15 A T 5: 109,286,388 S817T probably damaging Het
Ybx1 T C 4: 119,282,279 E173G probably damaging Het
Zc3h6 T C 2: 129,015,480 S640P possibly damaging Het
Other mutations in Rasef
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Rasef APN 4 73771425 nonsense probably null
IGL01329:Rasef APN 4 73727645 missense probably damaging 1.00
IGL01517:Rasef APN 4 73769822 missense probably benign 0.03
IGL02465:Rasef APN 4 73734488 missense probably damaging 1.00
IGL02676:Rasef APN 4 73759729 missense possibly damaging 0.69
IGL03137:Rasef APN 4 73734483 nonsense probably null
IGL03403:Rasef APN 4 73734534 missense probably damaging 1.00
BB001:Rasef UTSW 4 73740929 critical splice donor site probably null
P0033:Rasef UTSW 4 73749852 missense probably benign 0.26
R0035:Rasef UTSW 4 73762854 splice site probably benign
R0035:Rasef UTSW 4 73762854 splice site probably benign
R0317:Rasef UTSW 4 73748562 missense probably damaging 1.00
R0686:Rasef UTSW 4 73734534 missense probably damaging 1.00
R0987:Rasef UTSW 4 73734484 nonsense probably null
R1115:Rasef UTSW 4 73748604 missense possibly damaging 0.85
R1511:Rasef UTSW 4 73735748 missense probably damaging 1.00
R1585:Rasef UTSW 4 73740337 missense probably damaging 1.00
R1646:Rasef UTSW 4 73734549 missense probably damaging 1.00
R1705:Rasef UTSW 4 73744064 nonsense probably null
R1918:Rasef UTSW 4 73744114 missense possibly damaging 0.94
R1919:Rasef UTSW 4 73744114 missense possibly damaging 0.94
R3819:Rasef UTSW 4 73759705 missense probably damaging 1.00
R3891:Rasef UTSW 4 73780397 missense probably benign 0.03
R3892:Rasef UTSW 4 73780397 missense probably benign 0.03
R4344:Rasef UTSW 4 73745089 missense probably damaging 1.00
R4491:Rasef UTSW 4 73734503 missense probably damaging 1.00
R4492:Rasef UTSW 4 73734503 missense probably damaging 1.00
R4594:Rasef UTSW 4 73780389 missense possibly damaging 0.47
R4915:Rasef UTSW 4 73731459 missense probably damaging 1.00
R5276:Rasef UTSW 4 73735767 missense probably null 1.00
R5359:Rasef UTSW 4 73771328 missense probably damaging 1.00
R5682:Rasef UTSW 4 73740971 nonsense probably null
R5693:Rasef UTSW 4 73769839 missense probably damaging 0.99
R6414:Rasef UTSW 4 73740581 missense probably benign 0.13
R6543:Rasef UTSW 4 73780519 intron probably benign
R6593:Rasef UTSW 4 73745090 missense probably damaging 1.00
R7078:Rasef UTSW 4 73780389 missense probably benign 0.01
R7083:Rasef UTSW 4 73790984 missense probably benign 0.26
R7106:Rasef UTSW 4 73727627 missense probably damaging 1.00
R7127:Rasef UTSW 4 73744132 missense probably damaging 1.00
R7329:Rasef UTSW 4 73744137 missense probably damaging 1.00
R7767:Rasef UTSW 4 73734534 missense probably damaging 1.00
R7891:Rasef UTSW 4 73759698 missense probably benign 0.00
R7891:Rasef UTSW 4 73790964 missense probably benign
R7924:Rasef UTSW 4 73740929 critical splice donor site probably null
R7997:Rasef UTSW 4 73740562 missense possibly damaging 0.78
R8554:Rasef UTSW 4 73727607 missense probably benign 0.03
R8832:Rasef UTSW 4 73780321 intron probably benign
R8850:Rasef UTSW 4 73727603 missense probably damaging 1.00
R8985:Rasef UTSW 4 73790723 missense possibly damaging 0.48
R9093:Rasef UTSW 4 73780346 missense probably benign 0.00
R9179:Rasef UTSW 4 73744119 missense probably damaging 0.97
R9199:Rasef UTSW 4 73740388 missense possibly damaging 0.88
R9300:Rasef UTSW 4 73741156 missense probably benign
R9310:Rasef UTSW 4 73735719 critical splice donor site probably null
R9415:Rasef UTSW 4 73727645 missense probably benign 0.00
R9482:Rasef UTSW 4 73790696 missense probably benign 0.00
R9719:Rasef UTSW 4 73769865 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- TGTACTGCCAGTGTGGTTACTAAG -3'
(R):5'- TCTGTGACCCTCTGCAGAAG -3'

Sequencing Primer
(F):5'- GTGTGGTTACTAAGCAGACTCCC -3'
(R):5'- GACCCTCTGCAGAAGATGAATTATG -3'
Posted On 2020-08-01