Incidental Mutation 'BB011:Nox4'
ID642634
Institutional Source Beutler Lab
Gene Symbol Nox4
Ensembl Gene ENSMUSG00000030562
Gene NameNADPH oxidase 4
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #BB011
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location87246096-87398710 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 87374381 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 492 (V492L)
Ref Sequence ENSEMBL: ENSMUSP00000070039 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032781] [ENSMUST00000068829] [ENSMUST00000126887] [ENSMUST00000136577] [ENSMUST00000144267]
Predicted Effect probably benign
Transcript: ENSMUST00000032781
AA Change: V492L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000032781
Gene: ENSMUSG00000030562
AA Change: V492L

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Ferric_reduct 58 205 8.3e-21 PFAM
Pfam:FAD_binding_8 306 417 2.8e-17 PFAM
Pfam:NAD_binding_6 423 561 7.3e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000068829
AA Change: V492L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000070039
Gene: ENSMUSG00000030562
AA Change: V492L

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Ferric_reduct 58 205 5.3e-27 PFAM
Pfam:FAD_binding_8 306 417 5.5e-17 PFAM
Pfam:NAD_binding_6 423 539 4.3e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126887
SMART Domains Protein: ENSMUSP00000138336
Gene: ENSMUSG00000030562

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136577
SMART Domains Protein: ENSMUSP00000138274
Gene: ENSMUSG00000030562

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144267
SMART Domains Protein: ENSMUSP00000138143
Gene: ENSMUSG00000030562

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the NOX-family of enzymes that functions as the catalytic subunit the NADPH oxidase complex. The encoded protein is localized to non-phagocytic cells where it acts as an oxygen sensor and catalyzes the reduction of molecular oxygen to various reactive oxygen species (ROS). The ROS generated by this protein have been implicated in numerous biological functions including signal transduction, cell differentiation and tumor cell growth. A pseudogene has been identified on the other arm of chromosome 11. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Jan 2009]
PHENOTYPE: Mice homozygous for a null allele display increased heart damage following pressure overload. Mice with a cardiomyocyte specific deletion show decreased damage following pressure overload. Mice homozygous for a different knock-out allele exhibit decreased suseptibility to bleomycin-induced fibrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930435E12Rik G A 16: 38,812,464 Q369* probably null Het
Acacb A G 5: 114,245,220 K2155E possibly damaging Het
Adgre5 G A 8: 83,729,400 P256S possibly damaging Het
Adipor1 T A 1: 134,425,993 V172D probably damaging Het
Ahsa1 T C 12: 87,270,456 probably null Het
Ankrd11 T C 8: 122,895,902 I404V possibly damaging Het
Asxl3 G A 18: 22,525,545 R2204Q probably damaging Het
Barhl2 A G 5: 106,457,649 S65P unknown Het
Bbx A T 16: 50,224,308 L630H probably damaging Het
Cars T C 7: 143,569,871 T531A possibly damaging Het
Catsperb T A 12: 101,520,565 H450Q probably benign Het
Cdt1 T C 8: 122,569,352 L135P probably damaging Het
Cfap206 T A 4: 34,728,833 H24L probably benign Het
Cnga4 T A 7: 105,407,821 V480E probably benign Het
Cnot1 ACG A 8: 95,745,647 probably null Het
Ctcfl G A 2: 173,113,656 T271I possibly damaging Het
Dlc1 T C 8: 36,571,416 R1003G probably benign Het
Dnah7b A G 1: 46,219,430 D1927G probably benign Het
Dscc1 A T 15: 55,082,176 D374E probably benign Het
Eci2 G A 13: 34,993,070 Q69* probably null Het
Ep300 C A 15: 81,649,502 P1920Q unknown Het
Epha5 A G 5: 84,084,846 Y629H possibly damaging Het
Fam208b A T 13: 3,594,331 F129Y possibly damaging Het
Fat2 G A 11: 55,262,787 T3533I probably benign Het
Fat3 T C 9: 15,999,297 N1803S probably damaging Het
Fcrls T C 3: 87,259,533 Y51C probably damaging Het
G530012D18Rik C G 1: 85,577,214 D113E unknown Het
Gcnt2 A T 13: 40,918,564 K228* probably null Het
Gucy2c A T 6: 136,763,055 V258E probably benign Het
Hecw1 C A 13: 14,322,528 L298F probably damaging Het
Hydin T G 8: 110,418,471 V818G possibly damaging Het
Hykk A G 9: 54,922,240 Y131C probably damaging Het
Ick T C 9: 78,155,464 L260P probably damaging Het
Mpo A G 11: 87,794,840 D48G probably damaging Het
Mrps10 T C 17: 47,378,283 *202Q probably null Het
Mrps14 T C 1: 160,196,989 V30A probably benign Het
Mtmr7 G A 8: 40,606,884 A62V possibly damaging Het
Muc2 G T 7: 141,695,388 G497W probably damaging Het
Nnt A T 13: 119,386,645 V237D probably damaging Het
Obscn C G 11: 59,112,555 E1306Q probably benign Het
Olfr303 A G 7: 86,394,730 I256T probably damaging Het
Olfr993 T C 2: 85,414,219 Y220C probably benign Het
Pard3 A G 8: 127,410,750 N861S probably benign Het
Pdlim4 G A 11: 54,055,222 R230* probably null Het
Pinlyp C T 7: 24,542,125 V159M possibly damaging Het
Plcb1 A T 2: 135,359,693 T855S probably benign Het
Pot1a T A 6: 25,753,310 D409V possibly damaging Het
Prom1 T C 5: 44,029,769 D382G probably benign Het
Prss16 A T 13: 22,008,664 N83K probably damaging Het
Ptprn2 A G 12: 116,841,264 D133G probably benign Het
Rasef C T 4: 73,740,929 probably null Het
Rbak A G 5: 143,174,486 S271P probably damaging Het
Rbm20 A T 19: 53,677,585 I60F possibly damaging Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Rsf1 G GACGGCCGCC 7: 97,579,909 probably benign Het
Serpinb3c A G 1: 107,273,174 L171P probably damaging Het
Slc25a19 T C 11: 115,615,550 Y211C unknown Het
Sorbs2 C T 8: 45,795,470 S586L probably damaging Het
Spesp1 A T 9: 62,273,451 S58R probably benign Het
Spryd3 A G 15: 102,118,327 I329T probably benign Het
St8sia2 G A 7: 73,966,952 L113F probably damaging Het
Star T C 8: 25,809,855 I75T possibly damaging Het
Tdrd6 T A 17: 43,627,806 I784F possibly damaging Het
Tsc22d4 A G 5: 137,768,011 I144V unknown Het
Tspan8 T C 10: 115,833,324 probably null Het
Ttll9 C T 2: 152,962,487 probably benign Het
Ubr4 T G 4: 139,467,276 L1160R unknown Het
Ufd1 A G 16: 18,823,285 Y162C possibly damaging Het
Unc13c A T 9: 73,734,408 F1268I probably benign Het
Uvssa T C 5: 33,410,951 I561T probably damaging Het
Vmn2r15 A T 5: 109,286,388 S817T probably damaging Het
Ybx1 T C 4: 119,282,279 E173G probably damaging Het
Zc3h6 T C 2: 129,015,480 S640P possibly damaging Het
Other mutations in Nox4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01455:Nox4 APN 7 87376216 missense possibly damaging 0.89
IGL02711:Nox4 APN 7 87396868 missense probably damaging 1.00
IGL03234:Nox4 APN 7 87317313 critical splice donor site probably null
IGL03286:Nox4 APN 7 87370141 splice site probably benign
BB001:Nox4 UTSW 7 87374381 missense probably benign 0.00
LCD18:Nox4 UTSW 7 87243067 unclassified probably benign
PIT4151001:Nox4 UTSW 7 87304889 missense probably benign 0.02
R0717:Nox4 UTSW 7 87304890 nonsense probably null
R1033:Nox4 UTSW 7 87374413 missense probably damaging 0.99
R1135:Nox4 UTSW 7 87323789 missense probably damaging 1.00
R1333:Nox4 UTSW 7 87246864 missense possibly damaging 0.80
R1477:Nox4 UTSW 7 87295866 missense probably benign 0.16
R1489:Nox4 UTSW 7 87304889 missense probably damaging 0.99
R1579:Nox4 UTSW 7 87370023 missense probably damaging 0.98
R1669:Nox4 UTSW 7 87295889 missense probably benign 0.01
R1742:Nox4 UTSW 7 87295818 missense possibly damaging 0.82
R1900:Nox4 UTSW 7 87360796 nonsense probably null
R2112:Nox4 UTSW 7 87372008 missense probably damaging 1.00
R2192:Nox4 UTSW 7 87374380 missense probably benign 0.02
R2496:Nox4 UTSW 7 87306750 missense probably benign 0.04
R2497:Nox4 UTSW 7 87295876 nonsense probably null
R4158:Nox4 UTSW 7 87396824 missense possibly damaging 0.95
R4160:Nox4 UTSW 7 87396824 missense possibly damaging 0.95
R4281:Nox4 UTSW 7 87297524 missense possibly damaging 0.77
R4685:Nox4 UTSW 7 87297508 missense probably benign 0.36
R4791:Nox4 UTSW 7 87304847 missense probably benign 0.35
R5001:Nox4 UTSW 7 87360803 missense probably damaging 0.96
R5091:Nox4 UTSW 7 87376242 missense probably damaging 1.00
R5174:Nox4 UTSW 7 87323766 missense probably benign 0.10
R5220:Nox4 UTSW 7 87374408 missense possibly damaging 0.91
R5278:Nox4 UTSW 7 87371926 missense probably damaging 1.00
R5723:Nox4 UTSW 7 87304973 intron probably benign
R5840:Nox4 UTSW 7 87360793 missense probably benign 0.00
R5852:Nox4 UTSW 7 87338964 missense probably damaging 0.98
R7516:Nox4 UTSW 7 87321697 missense probably benign
R7529:Nox4 UTSW 7 87395768 missense unknown
R7587:Nox4 UTSW 7 87317302 missense probably damaging 1.00
R7643:Nox4 UTSW 7 87323754 missense probably damaging 1.00
R7660:Nox4 UTSW 7 87370022 missense probably damaging 0.97
R7786:Nox4 UTSW 7 87295842 missense probably damaging 0.99
R7871:Nox4 UTSW 7 87314127 missense possibly damaging 0.95
R7924:Nox4 UTSW 7 87374381 missense probably benign 0.00
R7934:Nox4 UTSW 7 87295824 missense probably damaging 1.00
R8024:Nox4 UTSW 7 87304910 missense probably damaging 0.99
R8053:Nox4 UTSW 7 87370047 missense probably damaging 1.00
R8376:Nox4 UTSW 7 87374384 missense probably damaging 1.00
R8461:Nox4 UTSW 7 87317271 missense probably damaging 0.99
X0021:Nox4 UTSW 7 87395678 missense probably damaging 1.00
Z1177:Nox4 UTSW 7 87395712 missense unknown
Predicted Primers PCR Primer
(F):5'- GTGAGAGAACTTGTGTATCATCTG -3'
(R):5'- CCTGGATGTATCCCAATAGAGGC -3'

Sequencing Primer
(F):5'- AGAACTTGTGTATCATCTGTCTGTC -3'
(R):5'- GGATGTATCCCAATAGAGGCTTTCC -3'
Posted On2020-08-01