Incidental Mutation 'BB011:Cars'
ID642638
Institutional Source Beutler Lab
Gene Symbol Cars
Ensembl Gene ENSMUSG00000010755
Gene Namecysteinyl-tRNA synthetase
SynonymsCA3
Accession Numbers

Genbank: NM_013742

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #BB011
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location143557230-143600090 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 143569871 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 531 (T531A)
Ref Sequence ENSEMBL: ENSMUSP00000010899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010899] [ENSMUST00000105909]
Predicted Effect possibly damaging
Transcript: ENSMUST00000010899
AA Change: T531A

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000010899
Gene: ENSMUSG00000010755
AA Change: T531A

DomainStartEndE-ValueType
Pfam:tRNA-synt_1e 124 537 2.7e-128 PFAM
Blast:DALR_2 584 644 2e-13 BLAST
coiled coil region 728 768 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105909
AA Change: T448A

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000101529
Gene: ENSMUSG00000010755
AA Change: T448A

DomainStartEndE-ValueType
Pfam:tRNA-synt_1e 41 454 2e-129 PFAM
Pfam:tRNA-synt_1g 387 465 1.2e-6 PFAM
Blast:DALR_2 501 561 1e-13 BLAST
coiled coil region 645 685 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000208575
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a class 1 aminoacyl-tRNA synthetase, cysteinyl-tRNA synthetase. Each of the twenty aminoacyl-tRNA synthetases catalyzes the aminoacylation of a specific tRNA or tRNA isoaccepting family with the cognate amino acid. This gene is one of several located near the imprinted gene domain on chromosome 11p15.5, an important tumor-suppressor gene region. Alterations in this region have been associated with Beckwith-Wiedemann syndrome, Wilms tumor, rhabdomyosarcoma, adrenocortical carcinoma, and lung, ovarian and breast cancers. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2010]
Allele List at MGI

All alleles(37) : Targeted, other(2) Gene trapped(35)

Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930435E12Rik G A 16: 38,812,464 Q369* probably null Het
Acacb A G 5: 114,245,220 K2155E possibly damaging Het
Adgre5 G A 8: 83,729,400 P256S possibly damaging Het
Adipor1 T A 1: 134,425,993 V172D probably damaging Het
Ahsa1 T C 12: 87,270,456 probably null Het
Ankrd11 T C 8: 122,895,902 I404V possibly damaging Het
Asxl3 G A 18: 22,525,545 R2204Q probably damaging Het
Barhl2 A G 5: 106,457,649 S65P unknown Het
Bbx A T 16: 50,224,308 L630H probably damaging Het
Catsperb T A 12: 101,520,565 H450Q probably benign Het
Cdt1 T C 8: 122,569,352 L135P probably damaging Het
Cfap206 T A 4: 34,728,833 H24L probably benign Het
Cnga4 T A 7: 105,407,821 V480E probably benign Het
Cnot1 ACG A 8: 95,745,647 probably null Het
Ctcfl G A 2: 173,113,656 T271I possibly damaging Het
Dlc1 T C 8: 36,571,416 R1003G probably benign Het
Dnah7b A G 1: 46,219,430 D1927G probably benign Het
Dscc1 A T 15: 55,082,176 D374E probably benign Het
Eci2 G A 13: 34,993,070 Q69* probably null Het
Ep300 C A 15: 81,649,502 P1920Q unknown Het
Epha5 A G 5: 84,084,846 Y629H possibly damaging Het
Fam208b A T 13: 3,594,331 F129Y possibly damaging Het
Fat2 G A 11: 55,262,787 T3533I probably benign Het
Fat3 T C 9: 15,999,297 N1803S probably damaging Het
Fcrls T C 3: 87,259,533 Y51C probably damaging Het
G530012D18Rik C G 1: 85,577,214 D113E unknown Het
Gcnt2 A T 13: 40,918,564 K228* probably null Het
Gucy2c A T 6: 136,763,055 V258E probably benign Het
Hecw1 C A 13: 14,322,528 L298F probably damaging Het
Hydin T G 8: 110,418,471 V818G possibly damaging Het
Hykk A G 9: 54,922,240 Y131C probably damaging Het
Ick T C 9: 78,155,464 L260P probably damaging Het
Mpo A G 11: 87,794,840 D48G probably damaging Het
Mrps10 T C 17: 47,378,283 *202Q probably null Het
Mrps14 T C 1: 160,196,989 V30A probably benign Het
Mtmr7 G A 8: 40,606,884 A62V possibly damaging Het
Muc2 G T 7: 141,695,388 G497W probably damaging Het
Nnt A T 13: 119,386,645 V237D probably damaging Het
Nox4 G T 7: 87,374,381 V492L probably benign Het
Obscn C G 11: 59,112,555 E1306Q probably benign Het
Olfr303 A G 7: 86,394,730 I256T probably damaging Het
Olfr993 T C 2: 85,414,219 Y220C probably benign Het
Pard3 A G 8: 127,410,750 N861S probably benign Het
Pdlim4 G A 11: 54,055,222 R230* probably null Het
Pinlyp C T 7: 24,542,125 V159M possibly damaging Het
Plcb1 A T 2: 135,359,693 T855S probably benign Het
Pot1a T A 6: 25,753,310 D409V possibly damaging Het
Prom1 T C 5: 44,029,769 D382G probably benign Het
Prss16 A T 13: 22,008,664 N83K probably damaging Het
Ptprn2 A G 12: 116,841,264 D133G probably benign Het
Rasef C T 4: 73,740,929 probably null Het
Rbak A G 5: 143,174,486 S271P probably damaging Het
Rbm20 A T 19: 53,677,585 I60F possibly damaging Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Rsf1 G GACGGCCGCC 7: 97,579,909 probably benign Het
Serpinb3c A G 1: 107,273,174 L171P probably damaging Het
Slc25a19 T C 11: 115,615,550 Y211C unknown Het
Sorbs2 C T 8: 45,795,470 S586L probably damaging Het
Spesp1 A T 9: 62,273,451 S58R probably benign Het
Spryd3 A G 15: 102,118,327 I329T probably benign Het
St8sia2 G A 7: 73,966,952 L113F probably damaging Het
Star T C 8: 25,809,855 I75T possibly damaging Het
Tdrd6 T A 17: 43,627,806 I784F possibly damaging Het
Tsc22d4 A G 5: 137,768,011 I144V unknown Het
Tspan8 T C 10: 115,833,324 probably null Het
Ttll9 C T 2: 152,962,487 probably benign Het
Ubr4 T G 4: 139,467,276 L1160R unknown Het
Ufd1 A G 16: 18,823,285 Y162C possibly damaging Het
Unc13c A T 9: 73,734,408 F1268I probably benign Het
Uvssa T C 5: 33,410,951 I561T probably damaging Het
Vmn2r15 A T 5: 109,286,388 S817T probably damaging Het
Ybx1 T C 4: 119,282,279 E173G probably damaging Het
Zc3h6 T C 2: 129,015,480 S640P possibly damaging Het
Other mutations in Cars
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01155:Cars APN 7 143569849 missense probably benign 0.03
IGL02192:Cars APN 7 143571588 missense probably damaging 1.00
IGL02645:Cars APN 7 143557909 missense probably damaging 0.97
IGL02807:Cars APN 7 143569472 missense possibly damaging 0.87
IGL02860:Cars APN 7 143586421 missense probably damaging 1.00
IGL03005:Cars APN 7 143559169 missense probably damaging 1.00
Vroom UTSW 7 143570648 missense probably damaging 1.00
Zoom UTSW 7 143592625 nonsense probably null
BB001:Cars UTSW 7 143569871 missense possibly damaging 0.88
F5493:Cars UTSW 7 143569871 missense probably damaging 1.00
R0358:Cars UTSW 7 143588482 splice site probably benign
R0452:Cars UTSW 7 143592625 nonsense probably null
R0717:Cars UTSW 7 143584755 missense probably damaging 0.98
R0930:Cars UTSW 7 143570570 missense probably damaging 1.00
R1069:Cars UTSW 7 143570107 missense probably benign 0.40
R1184:Cars UTSW 7 143587139 missense probably damaging 1.00
R1503:Cars UTSW 7 143568989 missense probably benign 0.04
R1755:Cars UTSW 7 143569457 missense probably damaging 1.00
R1762:Cars UTSW 7 143592474 missense probably damaging 1.00
R1783:Cars UTSW 7 143592474 missense probably damaging 1.00
R1786:Cars UTSW 7 143592474 missense probably damaging 1.00
R1828:Cars UTSW 7 143576648 missense probably damaging 0.97
R2084:Cars UTSW 7 143587182 missense probably benign 0.03
R2132:Cars UTSW 7 143592474 missense probably damaging 1.00
R2133:Cars UTSW 7 143592474 missense probably damaging 1.00
R2397:Cars UTSW 7 143592507 missense possibly damaging 0.61
R4012:Cars UTSW 7 143559674 missense possibly damaging 0.65
R4057:Cars UTSW 7 143570648 missense probably damaging 1.00
R4082:Cars UTSW 7 143569497 missense probably damaging 1.00
R4118:Cars UTSW 7 143559647 critical splice donor site probably null
R4527:Cars UTSW 7 143565049 missense probably benign 0.22
R4663:Cars UTSW 7 143575960 missense probably damaging 1.00
R4758:Cars UTSW 7 143571567 missense probably benign 0.01
R4820:Cars UTSW 7 143570564 missense probably damaging 1.00
R4921:Cars UTSW 7 143569475 missense probably damaging 1.00
R4923:Cars UTSW 7 143569850 missense probably damaging 0.97
R5512:Cars UTSW 7 143570133 missense possibly damaging 0.91
R6505:Cars UTSW 7 143565007 missense probably damaging 1.00
R7125:Cars UTSW 7 143584773 missense probably benign 0.01
R7641:Cars UTSW 7 143587103 critical splice donor site probably null
R7674:Cars UTSW 7 143587103 critical splice donor site probably null
R7812:Cars UTSW 7 143570047 missense probably damaging 1.00
R7924:Cars UTSW 7 143569871 missense possibly damaging 0.88
R8260:Cars UTSW 7 143585709 missense probably benign
R8447:Cars UTSW 7 143570029 missense possibly damaging 0.67
X0021:Cars UTSW 7 143576584 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGAAACGTGACATAGTCCCTGGG -3'
(R):5'- GCCTTGAAGAAGCACTCAGG -3'

Sequencing Primer
(F):5'- CCTGAGTCAGAATGAAATGGTCTGC -3'
(R):5'- AGCACTCAGGTGAGCACAGC -3'
Posted On2020-08-01