Incidental Mutation 'BB011:Dlc1'
ID642640
Institutional Source Beutler Lab
Gene Symbol Dlc1
Ensembl Gene ENSMUSG00000031523
Gene Namedeleted in liver cancer 1
SynonymsArhgap7, A730069N07Rik, STARD12, p122-RhoGAP
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #BB011
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location36567751-36953143 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 36571416 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 1003 (R1003G)
Ref Sequence ENSEMBL: ENSMUSP00000033923 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033923] [ENSMUST00000098826] [ENSMUST00000163663]
Predicted Effect probably benign
Transcript: ENSMUST00000033923
AA Change: R1003G

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000033923
Gene: ENSMUSG00000031523
AA Change: R1003G

DomainStartEndE-ValueType
Pfam:SAM_2 15 76 2.2e-7 PFAM
low complexity region 154 174 N/A INTRINSIC
low complexity region 238 250 N/A INTRINSIC
low complexity region 298 325 N/A INTRINSIC
low complexity region 427 441 N/A INTRINSIC
RhoGAP 653 845 8.82e-59 SMART
START 887 1088 3.93e-59 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098826
AA Change: R1037G

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000096425
Gene: ENSMUSG00000031523
AA Change: R1037G

DomainStartEndE-ValueType
Pfam:SAM_2 49 110 5.9e-8 PFAM
low complexity region 188 208 N/A INTRINSIC
low complexity region 272 284 N/A INTRINSIC
low complexity region 332 359 N/A INTRINSIC
low complexity region 461 475 N/A INTRINSIC
RhoGAP 687 879 8.82e-59 SMART
START 921 1122 3.93e-59 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163663
AA Change: R1454G

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000132812
Gene: ENSMUSG00000031523
AA Change: R1454G

DomainStartEndE-ValueType
low complexity region 353 369 N/A INTRINSIC
low complexity region 388 403 N/A INTRINSIC
Pfam:SAM_2 466 527 1.2e-7 PFAM
low complexity region 605 625 N/A INTRINSIC
low complexity region 689 701 N/A INTRINSIC
low complexity region 749 776 N/A INTRINSIC
low complexity region 878 892 N/A INTRINSIC
RhoGAP 1104 1296 8.82e-59 SMART
START 1338 1539 3.93e-59 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a GTPase-activating protein (GAP) that is a member of the rhoGAP family of proteins which play a role in the regulation of small GTP-binding proteins. GAP family proteins participate in signaling pathways that regulate cell processes involved in cytoskeletal changes. This gene functions as a tumor suppressor gene in a number of common cancers, including prostate, lung, colorectal, and breast cancers. Multiple transcript variants due to alternative promoters and alternative splicing have been found for this gene.[provided by RefSeq, Apr 2010]
PHENOTYPE: Homozygous mutants die by E10.5 with variable defects in the neural tube, heart, brain and placenta. Mouse embryonic fibroblasts homozygous for an activated conditional allele exhibti increased sensitivity to Ras-induced transformation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930435E12Rik G A 16: 38,812,464 Q369* probably null Het
Acacb A G 5: 114,245,220 K2155E possibly damaging Het
Adgre5 G A 8: 83,729,400 P256S possibly damaging Het
Adipor1 T A 1: 134,425,993 V172D probably damaging Het
Ahsa1 T C 12: 87,270,456 probably null Het
Ankrd11 T C 8: 122,895,902 I404V possibly damaging Het
Asxl3 G A 18: 22,525,545 R2204Q probably damaging Het
Barhl2 A G 5: 106,457,649 S65P unknown Het
Bbx A T 16: 50,224,308 L630H probably damaging Het
Cars T C 7: 143,569,871 T531A possibly damaging Het
Catsperb T A 12: 101,520,565 H450Q probably benign Het
Cdt1 T C 8: 122,569,352 L135P probably damaging Het
Cfap206 T A 4: 34,728,833 H24L probably benign Het
Cnga4 T A 7: 105,407,821 V480E probably benign Het
Cnot1 ACG A 8: 95,745,647 probably null Het
Ctcfl G A 2: 173,113,656 T271I possibly damaging Het
Dnah7b A G 1: 46,219,430 D1927G probably benign Het
Dscc1 A T 15: 55,082,176 D374E probably benign Het
Eci2 G A 13: 34,993,070 Q69* probably null Het
Ep300 C A 15: 81,649,502 P1920Q unknown Het
Epha5 A G 5: 84,084,846 Y629H possibly damaging Het
Fam208b A T 13: 3,594,331 F129Y possibly damaging Het
Fat2 G A 11: 55,262,787 T3533I probably benign Het
Fat3 T C 9: 15,999,297 N1803S probably damaging Het
Fcrls T C 3: 87,259,533 Y51C probably damaging Het
G530012D18Rik C G 1: 85,577,214 D113E unknown Het
Gcnt2 A T 13: 40,918,564 K228* probably null Het
Gucy2c A T 6: 136,763,055 V258E probably benign Het
Hecw1 C A 13: 14,322,528 L298F probably damaging Het
Hydin T G 8: 110,418,471 V818G possibly damaging Het
Hykk A G 9: 54,922,240 Y131C probably damaging Het
Ick T C 9: 78,155,464 L260P probably damaging Het
Mpo A G 11: 87,794,840 D48G probably damaging Het
Mrps10 T C 17: 47,378,283 *202Q probably null Het
Mrps14 T C 1: 160,196,989 V30A probably benign Het
Mtmr7 G A 8: 40,606,884 A62V possibly damaging Het
Muc2 G T 7: 141,695,388 G497W probably damaging Het
Nnt A T 13: 119,386,645 V237D probably damaging Het
Nox4 G T 7: 87,374,381 V492L probably benign Het
Obscn C G 11: 59,112,555 E1306Q probably benign Het
Olfr303 A G 7: 86,394,730 I256T probably damaging Het
Olfr993 T C 2: 85,414,219 Y220C probably benign Het
Pard3 A G 8: 127,410,750 N861S probably benign Het
Pdlim4 G A 11: 54,055,222 R230* probably null Het
Pinlyp C T 7: 24,542,125 V159M possibly damaging Het
Plcb1 A T 2: 135,359,693 T855S probably benign Het
Pot1a T A 6: 25,753,310 D409V possibly damaging Het
Prom1 T C 5: 44,029,769 D382G probably benign Het
Prss16 A T 13: 22,008,664 N83K probably damaging Het
Ptprn2 A G 12: 116,841,264 D133G probably benign Het
Rasef C T 4: 73,740,929 probably null Het
Rbak A G 5: 143,174,486 S271P probably damaging Het
Rbm20 A T 19: 53,677,585 I60F possibly damaging Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Rsf1 G GACGGCCGCC 7: 97,579,909 probably benign Het
Serpinb3c A G 1: 107,273,174 L171P probably damaging Het
Slc25a19 T C 11: 115,615,550 Y211C unknown Het
Sorbs2 C T 8: 45,795,470 S586L probably damaging Het
Spesp1 A T 9: 62,273,451 S58R probably benign Het
Spryd3 A G 15: 102,118,327 I329T probably benign Het
St8sia2 G A 7: 73,966,952 L113F probably damaging Het
Star T C 8: 25,809,855 I75T possibly damaging Het
Tdrd6 T A 17: 43,627,806 I784F possibly damaging Het
Tsc22d4 A G 5: 137,768,011 I144V unknown Het
Tspan8 T C 10: 115,833,324 probably null Het
Ttll9 C T 2: 152,962,487 probably benign Het
Ubr4 T G 4: 139,467,276 L1160R unknown Het
Ufd1 A G 16: 18,823,285 Y162C possibly damaging Het
Unc13c A T 9: 73,734,408 F1268I probably benign Het
Uvssa T C 5: 33,410,951 I561T probably damaging Het
Vmn2r15 A T 5: 109,286,388 S817T probably damaging Het
Ybx1 T C 4: 119,282,279 E173G probably damaging Het
Zc3h6 T C 2: 129,015,480 S640P possibly damaging Het
Other mutations in Dlc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Dlc1 APN 8 36570282 utr 3 prime probably benign
IGL00807:Dlc1 APN 8 36572848 missense probably benign 0.01
IGL00924:Dlc1 APN 8 36938214 missense probably benign
IGL01349:Dlc1 APN 8 36583824 missense probably damaging 0.96
IGL01419:Dlc1 APN 8 36850217 missense probably benign 0.02
IGL01871:Dlc1 APN 8 36850180 missense probably damaging 0.99
IGL01937:Dlc1 APN 8 36850191 missense probably benign 0.25
IGL02525:Dlc1 APN 8 36579646 missense probably damaging 1.00
IGL02696:Dlc1 APN 8 36574172 missense possibly damaging 0.65
IGL02826:Dlc1 APN 8 36570275 utr 3 prime probably benign
IGL03029:Dlc1 APN 8 36571262 splice site probably null
BB001:Dlc1 UTSW 8 36571416 missense probably benign 0.03
IGL02835:Dlc1 UTSW 8 36583901 missense probably damaging 1.00
R0068:Dlc1 UTSW 8 36937721 missense probably benign
R0068:Dlc1 UTSW 8 36937721 missense probably benign
R0164:Dlc1 UTSW 8 36599440 missense probably damaging 0.96
R0164:Dlc1 UTSW 8 36599440 missense probably damaging 0.96
R0218:Dlc1 UTSW 8 36850229 missense probably benign
R0419:Dlc1 UTSW 8 36583586 missense possibly damaging 0.69
R0513:Dlc1 UTSW 8 36584010 missense probably damaging 1.00
R0645:Dlc1 UTSW 8 36574049 missense possibly damaging 0.60
R0646:Dlc1 UTSW 8 36858051 missense probably benign
R0727:Dlc1 UTSW 8 36572674 missense probably damaging 0.99
R0792:Dlc1 UTSW 8 36938548 missense probably benign 0.00
R1061:Dlc1 UTSW 8 36858051 missense probably benign
R1221:Dlc1 UTSW 8 36584831 missense probably benign
R1440:Dlc1 UTSW 8 36593463 splice site probably benign
R1501:Dlc1 UTSW 8 36938148 missense probably benign 0.06
R1606:Dlc1 UTSW 8 36850252 missense probably benign
R1707:Dlc1 UTSW 8 36937609 missense probably benign 0.03
R1750:Dlc1 UTSW 8 36858090 splice site probably null
R1762:Dlc1 UTSW 8 36937585 missense probably benign 0.25
R2041:Dlc1 UTSW 8 36582768 missense probably damaging 1.00
R2055:Dlc1 UTSW 8 36593381 missense probably damaging 0.98
R2091:Dlc1 UTSW 8 36937609 missense probably benign 0.00
R2987:Dlc1 UTSW 8 36574152 missense probably damaging 0.97
R4285:Dlc1 UTSW 8 36574128 missense possibly damaging 0.49
R4294:Dlc1 UTSW 8 36584753 missense possibly damaging 0.47
R4631:Dlc1 UTSW 8 36937558 critical splice donor site probably null
R4828:Dlc1 UTSW 8 36850246 missense possibly damaging 0.69
R4867:Dlc1 UTSW 8 36584645 missense probably benign 0.01
R4902:Dlc1 UTSW 8 36577131 missense probably damaging 1.00
R5067:Dlc1 UTSW 8 36584493 missense probably benign 0.04
R5068:Dlc1 UTSW 8 36938030 missense probably benign
R5198:Dlc1 UTSW 8 36938398 missense probably damaging 1.00
R5471:Dlc1 UTSW 8 36584725 missense probably benign 0.26
R5668:Dlc1 UTSW 8 36937501 unclassified probably benign
R5915:Dlc1 UTSW 8 36938675 utr 5 prime probably benign
R6323:Dlc1 UTSW 8 36938383 missense possibly damaging 0.62
R6655:Dlc1 UTSW 8 36572716 missense probably damaging 1.00
R6908:Dlc1 UTSW 8 36937687 missense probably benign 0.02
R6914:Dlc1 UTSW 8 36938210 missense probably benign
R6942:Dlc1 UTSW 8 36938210 missense probably benign
R7269:Dlc1 UTSW 8 36579253 missense probably damaging 1.00
R7271:Dlc1 UTSW 8 36582800 missense probably damaging 0.99
R7462:Dlc1 UTSW 8 36937964 missense unknown
R7548:Dlc1 UTSW 8 36584655 missense probably benign 0.00
R7649:Dlc1 UTSW 8 36582740 missense probably damaging 1.00
R7924:Dlc1 UTSW 8 36571416 missense probably benign 0.03
R7960:Dlc1 UTSW 8 36937835 missense probably benign
R7984:Dlc1 UTSW 8 36938318 missense possibly damaging 0.85
R8227:Dlc1 UTSW 8 36572671 missense probably damaging 1.00
Z1176:Dlc1 UTSW 8 36584211 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTCGGGATCAGAATGTACC -3'
(R):5'- GACTGAGCATTTCCACCCTC -3'

Sequencing Primer
(F):5'- CCTTAAATCAGCTCTGCACATGTAGG -3'
(R):5'- AATGCCTCAGAGCTGGATCTCATG -3'
Posted On2020-08-01