Incidental Mutation 'BB011:Hydin'

• ID: 642645
• Institutional Source: Beutler Lab
• Gene Symbol: Hydin
• Ensembl Gene: ENSMUSG00000059854
• Gene Name: HYDIN, axonemal central pair apparatus protein
• Synonyms: hy-3, hyrh, hy3, 1700034M11Rik, 4930545D19Rik
• Accession Numbers:

  Ncbi RefSeq: NM_172916; MGI: 2389007

• Essential gene?: Probably essential (E-score: 0.797)
• Stock #: BB011
• Quality Score: 225.009
• Status: Not validated
• Chromosome: 8
• Chromosomal Location: 110266977-110610253 bp(+) (GRCm38)
• Type of Mutation: missense
• DNA Base Change (assembly): T to G at 110418471 bp (GRCm38)
• Zygosity: Heterozygous
• Amino Acid Change: Valine to Glycine at position 818 (V818G)
• Ref Sequence: ENSEMBL: ENSMUSP00000046204
• Gene Model: predicted gene model for transcript(s): [ENSMUST00000043141]
• AlphaFold: no structure available at present
• Predicted Effect: possibly damaging; Transcript: ENSMUST00000043141; AA Change: V818G; PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
• SMART Domains: Protein: ENSMUSP00000046204; Gene: ENSMUSG00000059854; AA Change: V818G

Domain	Start	End	E-Value	Type
Pfam:Motile_Sperm	246	325	5.6e-8	PFAM
Pfam:ASH	559	659	9.4e-17	PFAM
low complexity region	788	798	N/A	INTRINSIC
Pfam:PapD-like	848	906	1.2e-6	PFAM
low complexity region	998	1024	N/A	INTRINSIC
low complexity region	1279	1292	N/A	INTRINSIC
internal_repeat_6	1317	1549	5.96e-5	PROSPERO
internal_repeat_5	1355	1502	3.23e-5	PROSPERO
low complexity region	1574	1590	N/A	INTRINSIC
internal_repeat_4	1712	1940	5.14e-6	PROSPERO
coiled coil region	1947	1977	N/A	INTRINSIC
low complexity region	2009	2020	N/A	INTRINSIC
low complexity region	2034	2049	N/A	INTRINSIC
SCOP:d1eq1a_	2305	2403	3e-4	SMART
low complexity region	2404	2419	N/A	INTRINSIC
coiled coil region	2543	2588	N/A	INTRINSIC
low complexity region	2636	2656	N/A	INTRINSIC
internal_repeat_7	2772	3008	8.1e-5	PROSPERO
low complexity region	3660	3670	N/A	INTRINSIC
low complexity region	3919	3934	N/A	INTRINSIC
internal_repeat_5	4046	4190	3.23e-5	PROSPERO
internal_repeat_2	4106	4251	6.03e-7	PROSPERO
internal_repeat_4	4317	4532	5.14e-6	PROSPERO
internal_repeat_3	4403	4689	2.05e-6	PROSPERO
internal_repeat_2	4549	4697	6.03e-7	PROSPERO
low complexity region	4951	4964	N/A	INTRINSIC

• Meta Mutation Damage Score: 0.1019
• Coding Region Coverage:
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
• MGI Phenotype: Strain: 1856913; 3801608; Lethality: D28-D42; FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may be involved in cilia motility. Mutations in this gene cause of autosomal recessive primary ciliary dyskinesia-5, a disorder characterized by the accumulation of cerebrospinal fluid within the ventricles of the brain. A duplicate copy of this gene has been found in humans on chromosome 1. [provided by RefSeq, Jan 2013] ; PHENOTYPE: Mice homozygous for a mutation in this gene develop hydrocephaly after birth. Symptoms develop after 3-5 days. Affected animals usually die before 2 months of age. [provided by MGI curators]
• Allele List at MGI:

  All alleles(7) : Targeted(1) Gene trapped(3) Transgenic(1) Spontaneous(2)

• Posted On: 2020-08-01

Predicted Primers

PCR Primer
(F):5'- TGGACTCTGAACAACACTTGC -3'
(R):5'- GCATCTGCATACAGTTTCTTCAGG -3'

Sequencing Primer
(F):5'- GCTTCAAAATAAACCATTATGGCG -3'
(R):5'- ACACACATGTTTTACTTCTGCAG -3'