Incidental Mutation 'BB011:Cdt1'
ID642646
Institutional Source Beutler Lab
Gene Symbol Cdt1
Ensembl Gene ENSMUSG00000006585
Gene Namechromatin licensing and DNA replication factor 1
Synonyms2610318F11Rik, Ris2
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock #BB011
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location122568015-122573554 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 122569352 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 135 (L135P)
Ref Sequence ENSEMBL: ENSMUSP00000006760 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006760] [ENSMUST00000127664]
PDB Structure
Structure of the Cdt1 C-terminal domain [SOLUTION NMR]
Structure of C-terminal region of Cdt1 [SOLUTION NMR]
Crystal structure of Cdt1/geminin complex [X-RAY DIFFRACTION]
Crystal structure of cdt1 C terminal domain [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000006760
AA Change: L135P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000006760
Gene: ENSMUSG00000006585
AA Change: L135P

DomainStartEndE-ValueType
low complexity region 41 52 N/A INTRINSIC
low complexity region 59 70 N/A INTRINSIC
low complexity region 72 108 N/A INTRINSIC
CDT1 199 362 3.68e-91 SMART
low complexity region 401 427 N/A INTRINSIC
Pfam:CDT1_C 431 525 1.4e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in the formation of the pre-replication complex that is necessary for DNA replication. The encoded protein can bind geminin, which prevents replication and may function to prevent this protein from initiating replication at inappropriate origins. Phosphorylation of this protein by cyclin A-dependent kinases results in degradation of the protein. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a small in-frame deletion in exon 2 are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930435E12Rik G A 16: 38,812,464 Q369* probably null Het
Acacb A G 5: 114,245,220 K2155E possibly damaging Het
Adgre5 G A 8: 83,729,400 P256S possibly damaging Het
Adipor1 T A 1: 134,425,993 V172D probably damaging Het
Ahsa1 T C 12: 87,270,456 probably null Het
Ankrd11 T C 8: 122,895,902 I404V possibly damaging Het
Asxl3 G A 18: 22,525,545 R2204Q probably damaging Het
Barhl2 A G 5: 106,457,649 S65P unknown Het
Bbx A T 16: 50,224,308 L630H probably damaging Het
Cars T C 7: 143,569,871 T531A possibly damaging Het
Catsperb T A 12: 101,520,565 H450Q probably benign Het
Cfap206 T A 4: 34,728,833 H24L probably benign Het
Cnga4 T A 7: 105,407,821 V480E probably benign Het
Cnot1 ACG A 8: 95,745,647 probably null Het
Ctcfl G A 2: 173,113,656 T271I possibly damaging Het
Dlc1 T C 8: 36,571,416 R1003G probably benign Het
Dnah7b A G 1: 46,219,430 D1927G probably benign Het
Dscc1 A T 15: 55,082,176 D374E probably benign Het
Eci2 G A 13: 34,993,070 Q69* probably null Het
Ep300 C A 15: 81,649,502 P1920Q unknown Het
Epha5 A G 5: 84,084,846 Y629H possibly damaging Het
Fam208b A T 13: 3,594,331 F129Y possibly damaging Het
Fat2 G A 11: 55,262,787 T3533I probably benign Het
Fat3 T C 9: 15,999,297 N1803S probably damaging Het
Fcrls T C 3: 87,259,533 Y51C probably damaging Het
G530012D18Rik C G 1: 85,577,214 D113E unknown Het
Gcnt2 A T 13: 40,918,564 K228* probably null Het
Gucy2c A T 6: 136,763,055 V258E probably benign Het
Hecw1 C A 13: 14,322,528 L298F probably damaging Het
Hydin T G 8: 110,418,471 V818G possibly damaging Het
Hykk A G 9: 54,922,240 Y131C probably damaging Het
Ick T C 9: 78,155,464 L260P probably damaging Het
Mpo A G 11: 87,794,840 D48G probably damaging Het
Mrps10 T C 17: 47,378,283 *202Q probably null Het
Mrps14 T C 1: 160,196,989 V30A probably benign Het
Mtmr7 G A 8: 40,606,884 A62V possibly damaging Het
Muc2 G T 7: 141,695,388 G497W probably damaging Het
Nnt A T 13: 119,386,645 V237D probably damaging Het
Nox4 G T 7: 87,374,381 V492L probably benign Het
Obscn C G 11: 59,112,555 E1306Q probably benign Het
Olfr303 A G 7: 86,394,730 I256T probably damaging Het
Olfr993 T C 2: 85,414,219 Y220C probably benign Het
Pard3 A G 8: 127,410,750 N861S probably benign Het
Pdlim4 G A 11: 54,055,222 R230* probably null Het
Pinlyp C T 7: 24,542,125 V159M possibly damaging Het
Plcb1 A T 2: 135,359,693 T855S probably benign Het
Pot1a T A 6: 25,753,310 D409V possibly damaging Het
Prom1 T C 5: 44,029,769 D382G probably benign Het
Prss16 A T 13: 22,008,664 N83K probably damaging Het
Ptprn2 A G 12: 116,841,264 D133G probably benign Het
Rasef C T 4: 73,740,929 probably null Het
Rbak A G 5: 143,174,486 S271P probably damaging Het
Rbm20 A T 19: 53,677,585 I60F possibly damaging Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Rsf1 G GACGGCCGCC 7: 97,579,909 probably benign Het
Serpinb3c A G 1: 107,273,174 L171P probably damaging Het
Slc25a19 T C 11: 115,615,550 Y211C unknown Het
Sorbs2 C T 8: 45,795,470 S586L probably damaging Het
Spesp1 A T 9: 62,273,451 S58R probably benign Het
Spryd3 A G 15: 102,118,327 I329T probably benign Het
St8sia2 G A 7: 73,966,952 L113F probably damaging Het
Star T C 8: 25,809,855 I75T possibly damaging Het
Tdrd6 T A 17: 43,627,806 I784F possibly damaging Het
Tsc22d4 A G 5: 137,768,011 I144V unknown Het
Tspan8 T C 10: 115,833,324 probably null Het
Ttll9 C T 2: 152,962,487 probably benign Het
Ubr4 T G 4: 139,467,276 L1160R unknown Het
Ufd1 A G 16: 18,823,285 Y162C possibly damaging Het
Unc13c A T 9: 73,734,408 F1268I probably benign Het
Uvssa T C 5: 33,410,951 I561T probably damaging Het
Vmn2r15 A T 5: 109,286,388 S817T probably damaging Het
Ybx1 T C 4: 119,282,279 E173G probably damaging Het
Zc3h6 T C 2: 129,015,480 S640P possibly damaging Het
Other mutations in Cdt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
BB001:Cdt1 UTSW 8 122569352 missense probably damaging 1.00
R0014:Cdt1 UTSW 8 122572566 missense probably benign 0.00
R0494:Cdt1 UTSW 8 122572060 missense possibly damaging 0.64
R0614:Cdt1 UTSW 8 122568137 missense probably benign 0.04
R0645:Cdt1 UTSW 8 122572145 unclassified probably benign
R1699:Cdt1 UTSW 8 122569983 missense probably damaging 0.99
R1889:Cdt1 UTSW 8 122572052 missense possibly damaging 0.85
R3114:Cdt1 UTSW 8 122570482 nonsense probably null
R4243:Cdt1 UTSW 8 122571418 missense probably benign 0.04
R4532:Cdt1 UTSW 8 122571756 missense probably benign 0.00
R5496:Cdt1 UTSW 8 122570500 missense probably damaging 0.99
R5498:Cdt1 UTSW 8 122570500 missense probably damaging 0.99
R5501:Cdt1 UTSW 8 122570500 missense probably damaging 0.99
R5523:Cdt1 UTSW 8 122568093 missense possibly damaging 0.95
R5647:Cdt1 UTSW 8 122570208 missense possibly damaging 0.79
R6160:Cdt1 UTSW 8 122571368 missense probably benign 0.36
R6892:Cdt1 UTSW 8 122570212 missense probably damaging 1.00
R7001:Cdt1 UTSW 8 122572510 missense probably damaging 1.00
R7089:Cdt1 UTSW 8 122571980 missense probably damaging 1.00
R7214:Cdt1 UTSW 8 122568273 critical splice donor site probably null
R7583:Cdt1 UTSW 8 122570256 missense probably damaging 0.99
R7924:Cdt1 UTSW 8 122569352 missense probably damaging 1.00
R7976:Cdt1 UTSW 8 122571846 missense probably damaging 1.00
R8116:Cdt1 UTSW 8 122571989 missense probably benign 0.05
R8236:Cdt1 UTSW 8 122572028 missense probably damaging 1.00
R8436:Cdt1 UTSW 8 122569331 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGCCTTCTTAATCGCCAGGAC -3'
(R):5'- TACGGTTTAGGCCATCCACC -3'

Sequencing Primer
(F):5'- AGTTCTCTGCCTGAGCCCAG -3'
(R):5'- TTTAGGCCATCCACCCACTCAG -3'
Posted On2020-08-01