Incidental Mutation 'BB011:Ankrd11'
ID642647
Institutional Source Beutler Lab
Gene Symbol Ankrd11
Ensembl Gene ENSMUSG00000035569
Gene Nameankyrin repeat domain 11
Synonyms3010027A04Rik, Yod, 2410104C19Rik, 9530048I21Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #BB011
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location122883822-123042277 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 122895902 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 404 (I404V)
Ref Sequence ENSEMBL: ENSMUSP00000095938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098333] [ENSMUST00000098334] [ENSMUST00000127664] [ENSMUST00000172906]
Predicted Effect possibly damaging
Transcript: ENSMUST00000098333
AA Change: I404V

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000095938
Gene: ENSMUSG00000035569
AA Change: I404V

DomainStartEndE-ValueType
ANK 188 217 2.58e-3 SMART
ANK 221 250 1.31e-4 SMART
ANK 254 283 5.04e-6 SMART
low complexity region 311 324 N/A INTRINSIC
low complexity region 366 377 N/A INTRINSIC
low complexity region 429 440 N/A INTRINSIC
low complexity region 470 487 N/A INTRINSIC
low complexity region 499 521 N/A INTRINSIC
low complexity region 534 549 N/A INTRINSIC
low complexity region 596 609 N/A INTRINSIC
low complexity region 649 669 N/A INTRINSIC
coiled coil region 786 826 N/A INTRINSIC
low complexity region 867 877 N/A INTRINSIC
low complexity region 965 984 N/A INTRINSIC
low complexity region 1040 1055 N/A INTRINSIC
low complexity region 1058 1082 N/A INTRINSIC
low complexity region 1187 1200 N/A INTRINSIC
low complexity region 1204 1227 N/A INTRINSIC
low complexity region 1268 1289 N/A INTRINSIC
low complexity region 1294 1306 N/A INTRINSIC
coiled coil region 1374 1406 N/A INTRINSIC
low complexity region 1476 1496 N/A INTRINSIC
low complexity region 1508 1523 N/A INTRINSIC
low complexity region 1526 1547 N/A INTRINSIC
coiled coil region 1598 1625 N/A INTRINSIC
low complexity region 1770 1781 N/A INTRINSIC
low complexity region 1874 1885 N/A INTRINSIC
low complexity region 1913 1922 N/A INTRINSIC
low complexity region 1969 1979 N/A INTRINSIC
low complexity region 2035 2045 N/A INTRINSIC
low complexity region 2057 2071 N/A INTRINSIC
low complexity region 2162 2179 N/A INTRINSIC
low complexity region 2191 2209 N/A INTRINSIC
low complexity region 2224 2236 N/A INTRINSIC
low complexity region 2250 2263 N/A INTRINSIC
low complexity region 2294 2305 N/A INTRINSIC
low complexity region 2391 2409 N/A INTRINSIC
low complexity region 2445 2455 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000098334
AA Change: I383V

PolyPhen 2 Score 0.785 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000095939
Gene: ENSMUSG00000035569
AA Change: I383V

DomainStartEndE-ValueType
ANK 167 196 2.58e-3 SMART
ANK 200 229 1.31e-4 SMART
ANK 233 262 5.04e-6 SMART
low complexity region 290 303 N/A INTRINSIC
low complexity region 345 356 N/A INTRINSIC
low complexity region 408 419 N/A INTRINSIC
low complexity region 449 466 N/A INTRINSIC
low complexity region 478 500 N/A INTRINSIC
low complexity region 513 528 N/A INTRINSIC
low complexity region 575 588 N/A INTRINSIC
low complexity region 628 648 N/A INTRINSIC
coiled coil region 765 805 N/A INTRINSIC
low complexity region 846 856 N/A INTRINSIC
low complexity region 944 963 N/A INTRINSIC
low complexity region 1019 1034 N/A INTRINSIC
low complexity region 1037 1061 N/A INTRINSIC
low complexity region 1166 1179 N/A INTRINSIC
low complexity region 1183 1206 N/A INTRINSIC
low complexity region 1247 1268 N/A INTRINSIC
low complexity region 1273 1285 N/A INTRINSIC
coiled coil region 1353 1385 N/A INTRINSIC
low complexity region 1455 1475 N/A INTRINSIC
low complexity region 1487 1502 N/A INTRINSIC
low complexity region 1505 1526 N/A INTRINSIC
coiled coil region 1577 1604 N/A INTRINSIC
low complexity region 1749 1760 N/A INTRINSIC
low complexity region 1853 1864 N/A INTRINSIC
low complexity region 1892 1901 N/A INTRINSIC
low complexity region 1948 1958 N/A INTRINSIC
low complexity region 2014 2024 N/A INTRINSIC
low complexity region 2036 2050 N/A INTRINSIC
low complexity region 2141 2158 N/A INTRINSIC
low complexity region 2170 2188 N/A INTRINSIC
low complexity region 2203 2215 N/A INTRINSIC
low complexity region 2229 2242 N/A INTRINSIC
low complexity region 2273 2284 N/A INTRINSIC
low complexity region 2370 2388 N/A INTRINSIC
low complexity region 2424 2434 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172906
Predicted Effect probably benign
Transcript: ENSMUST00000212050
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes an ankryin repeat domain-containing protein. The encoded protein inhibits ligand-dependent activation of transcription. Mutations in this gene have been associated with KBG syndrome, which is characterized by macrodontia, distinctive craniofacial features, short stature, skeletal anomalies, global developmental delay, seizures and intellectual disability. Alternatively spliced transcript variants have been described. Related pseudogenes exist on chromosomes 2 and X. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a spontaneous allele die by E9.5, are small and fail to turn. Mice heterozygous for a spontaneous allele exhibit craniofacial abnormalities, decreased weight, osteoporosis and osteopenia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930435E12Rik G A 16: 38,812,464 Q369* probably null Het
Acacb A G 5: 114,245,220 K2155E possibly damaging Het
Adgre5 G A 8: 83,729,400 P256S possibly damaging Het
Adipor1 T A 1: 134,425,993 V172D probably damaging Het
Ahsa1 T C 12: 87,270,456 probably null Het
Asxl3 G A 18: 22,525,545 R2204Q probably damaging Het
Barhl2 A G 5: 106,457,649 S65P unknown Het
Bbx A T 16: 50,224,308 L630H probably damaging Het
Cars T C 7: 143,569,871 T531A possibly damaging Het
Catsperb T A 12: 101,520,565 H450Q probably benign Het
Cdt1 T C 8: 122,569,352 L135P probably damaging Het
Cfap206 T A 4: 34,728,833 H24L probably benign Het
Cnga4 T A 7: 105,407,821 V480E probably benign Het
Cnot1 ACG A 8: 95,745,647 probably null Het
Ctcfl G A 2: 173,113,656 T271I possibly damaging Het
Dlc1 T C 8: 36,571,416 R1003G probably benign Het
Dnah7b A G 1: 46,219,430 D1927G probably benign Het
Dscc1 A T 15: 55,082,176 D374E probably benign Het
Eci2 G A 13: 34,993,070 Q69* probably null Het
Ep300 C A 15: 81,649,502 P1920Q unknown Het
Epha5 A G 5: 84,084,846 Y629H possibly damaging Het
Fam208b A T 13: 3,594,331 F129Y possibly damaging Het
Fat2 G A 11: 55,262,787 T3533I probably benign Het
Fat3 T C 9: 15,999,297 N1803S probably damaging Het
Fcrls T C 3: 87,259,533 Y51C probably damaging Het
G530012D18Rik C G 1: 85,577,214 D113E unknown Het
Gcnt2 A T 13: 40,918,564 K228* probably null Het
Gucy2c A T 6: 136,763,055 V258E probably benign Het
Hecw1 C A 13: 14,322,528 L298F probably damaging Het
Hydin T G 8: 110,418,471 V818G possibly damaging Het
Hykk A G 9: 54,922,240 Y131C probably damaging Het
Ick T C 9: 78,155,464 L260P probably damaging Het
Mpo A G 11: 87,794,840 D48G probably damaging Het
Mrps10 T C 17: 47,378,283 *202Q probably null Het
Mrps14 T C 1: 160,196,989 V30A probably benign Het
Mtmr7 G A 8: 40,606,884 A62V possibly damaging Het
Muc2 G T 7: 141,695,388 G497W probably damaging Het
Nnt A T 13: 119,386,645 V237D probably damaging Het
Nox4 G T 7: 87,374,381 V492L probably benign Het
Obscn C G 11: 59,112,555 E1306Q probably benign Het
Olfr303 A G 7: 86,394,730 I256T probably damaging Het
Olfr993 T C 2: 85,414,219 Y220C probably benign Het
Pard3 A G 8: 127,410,750 N861S probably benign Het
Pdlim4 G A 11: 54,055,222 R230* probably null Het
Pinlyp C T 7: 24,542,125 V159M possibly damaging Het
Plcb1 A T 2: 135,359,693 T855S probably benign Het
Pot1a T A 6: 25,753,310 D409V possibly damaging Het
Prom1 T C 5: 44,029,769 D382G probably benign Het
Prss16 A T 13: 22,008,664 N83K probably damaging Het
Ptprn2 A G 12: 116,841,264 D133G probably benign Het
Rasef C T 4: 73,740,929 probably null Het
Rbak A G 5: 143,174,486 S271P probably damaging Het
Rbm20 A T 19: 53,677,585 I60F possibly damaging Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Rsf1 G GACGGCCGCC 7: 97,579,909 probably benign Het
Serpinb3c A G 1: 107,273,174 L171P probably damaging Het
Slc25a19 T C 11: 115,615,550 Y211C unknown Het
Sorbs2 C T 8: 45,795,470 S586L probably damaging Het
Spesp1 A T 9: 62,273,451 S58R probably benign Het
Spryd3 A G 15: 102,118,327 I329T probably benign Het
St8sia2 G A 7: 73,966,952 L113F probably damaging Het
Star T C 8: 25,809,855 I75T possibly damaging Het
Tdrd6 T A 17: 43,627,806 I784F possibly damaging Het
Tsc22d4 A G 5: 137,768,011 I144V unknown Het
Tspan8 T C 10: 115,833,324 probably null Het
Ttll9 C T 2: 152,962,487 probably benign Het
Ubr4 T G 4: 139,467,276 L1160R unknown Het
Ufd1 A G 16: 18,823,285 Y162C possibly damaging Het
Unc13c A T 9: 73,734,408 F1268I probably benign Het
Uvssa T C 5: 33,410,951 I561T probably damaging Het
Vmn2r15 A T 5: 109,286,388 S817T probably damaging Het
Ybx1 T C 4: 119,282,279 E173G probably damaging Het
Zc3h6 T C 2: 129,015,480 S640P possibly damaging Het
Other mutations in Ankrd11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00949:Ankrd11 APN 8 122908728 missense possibly damaging 0.59
IGL00971:Ankrd11 APN 8 122895353 missense probably damaging 1.00
IGL01017:Ankrd11 APN 8 122894728 missense probably damaging 1.00
IGL01137:Ankrd11 APN 8 122884336 missense probably damaging 0.99
IGL01659:Ankrd11 APN 8 122895371 missense probably damaging 1.00
IGL01920:Ankrd11 APN 8 122915897 splice site probably benign
IGL01964:Ankrd11 APN 8 122889736 missense probably damaging 0.97
IGL02131:Ankrd11 APN 8 122894410 missense probably damaging 1.00
IGL02226:Ankrd11 APN 8 122892245 missense probably damaging 1.00
IGL02549:Ankrd11 APN 8 122891293 missense probably damaging 1.00
IGL02642:Ankrd11 APN 8 122890651 missense probably damaging 1.00
IGL02643:Ankrd11 APN 8 122892322 missense probably damaging 0.98
IGL02861:Ankrd11 APN 8 122895827 missense probably damaging 0.99
IGL03086:Ankrd11 APN 8 122894510 missense probably damaging 1.00
IGL03336:Ankrd11 APN 8 122891843 missense probably benign 0.00
anchors UTSW 8 122895770 missense probably damaging 0.99
away UTSW 8 122891953 missense probably damaging 1.00
bluebell UTSW 8 122891785 missense probably damaging 0.97
Navy UTSW 8 122908734 nonsense probably null
BB001:Ankrd11 UTSW 8 122895902 missense possibly damaging 0.95
R0051:Ankrd11 UTSW 8 122889742 missense probably damaging 1.00
R0051:Ankrd11 UTSW 8 122889742 missense probably damaging 1.00
R0110:Ankrd11 UTSW 8 122892175 missense possibly damaging 0.95
R0281:Ankrd11 UTSW 8 122895568 missense probably benign 0.01
R0450:Ankrd11 UTSW 8 122892175 missense possibly damaging 0.95
R0481:Ankrd11 UTSW 8 122900036 missense probably damaging 1.00
R0542:Ankrd11 UTSW 8 122895770 missense probably damaging 0.99
R0606:Ankrd11 UTSW 8 122892832 missense probably benign 0.04
R0702:Ankrd11 UTSW 8 122889766 missense probably damaging 1.00
R0730:Ankrd11 UTSW 8 122891953 missense probably damaging 1.00
R0737:Ankrd11 UTSW 8 122895836 missense probably damaging 0.99
R1401:Ankrd11 UTSW 8 122893050 missense probably benign 0.23
R1464:Ankrd11 UTSW 8 122892724 missense probably damaging 1.00
R1464:Ankrd11 UTSW 8 122892724 missense probably damaging 1.00
R1470:Ankrd11 UTSW 8 122899724 missense probably damaging 0.98
R1470:Ankrd11 UTSW 8 122899724 missense probably damaging 0.98
R1641:Ankrd11 UTSW 8 122891746 missense probably benign 0.03
R1950:Ankrd11 UTSW 8 122889869 missense probably damaging 1.00
R2004:Ankrd11 UTSW 8 122902422 critical splice donor site probably null
R2401:Ankrd11 UTSW 8 122908734 nonsense probably null
R2425:Ankrd11 UTSW 8 122893163 missense possibly damaging 0.86
R2830:Ankrd11 UTSW 8 122892196 missense probably damaging 1.00
R2910:Ankrd11 UTSW 8 122908798 missense probably damaging 1.00
R2911:Ankrd11 UTSW 8 122908798 missense probably damaging 1.00
R3736:Ankrd11 UTSW 8 122891785 missense probably damaging 0.97
R3738:Ankrd11 UTSW 8 122896715 unclassified probably benign
R3739:Ankrd11 UTSW 8 122896715 unclassified probably benign
R3813:Ankrd11 UTSW 8 122891378 missense probably benign
R4012:Ankrd11 UTSW 8 122892417 missense probably damaging 0.98
R4183:Ankrd11 UTSW 8 122899676 missense possibly damaging 0.88
R4213:Ankrd11 UTSW 8 122891026 missense probably benign 0.00
R4469:Ankrd11 UTSW 8 122896587 missense probably damaging 1.00
R4482:Ankrd11 UTSW 8 122893489 missense probably damaging 1.00
R4935:Ankrd11 UTSW 8 122900183 missense probably benign 0.02
R4940:Ankrd11 UTSW 8 122889821 missense probably damaging 1.00
R5145:Ankrd11 UTSW 8 122891204 utr 3 prime probably benign
R5154:Ankrd11 UTSW 8 122893139 missense probably damaging 1.00
R5230:Ankrd11 UTSW 8 122890477 missense probably benign 0.11
R5283:Ankrd11 UTSW 8 122884182 missense probably damaging 1.00
R5377:Ankrd11 UTSW 8 122893714 splice site probably null
R5513:Ankrd11 UTSW 8 122892520 missense probably benign 0.38
R5518:Ankrd11 UTSW 8 122890994 missense possibly damaging 0.93
R5549:Ankrd11 UTSW 8 122890378 missense probably benign 0.02
R5579:Ankrd11 UTSW 8 122884231 missense probably damaging 0.97
R5595:Ankrd11 UTSW 8 122894304 nonsense probably null
R5650:Ankrd11 UTSW 8 122887397 missense probably damaging 0.99
R5717:Ankrd11 UTSW 8 122892638 missense possibly damaging 0.92
R5753:Ankrd11 UTSW 8 122895304 missense possibly damaging 0.90
R5782:Ankrd11 UTSW 8 122900017 missense probably damaging 1.00
R5812:Ankrd11 UTSW 8 122893805 splice site probably null
R5823:Ankrd11 UTSW 8 122895790 missense probably benign 0.12
R5900:Ankrd11 UTSW 8 122891066 missense probably benign 0.00
R5975:Ankrd11 UTSW 8 122889749 missense possibly damaging 0.93
R5979:Ankrd11 UTSW 8 122892400 missense probably damaging 1.00
R6000:Ankrd11 UTSW 8 122891195 missense possibly damaging 0.73
R6145:Ankrd11 UTSW 8 122892661 missense probably damaging 1.00
R6252:Ankrd11 UTSW 8 122893822 missense possibly damaging 0.87
R6302:Ankrd11 UTSW 8 122889989 missense probably benign
R6457:Ankrd11 UTSW 8 122908764 missense probably damaging 1.00
R6513:Ankrd11 UTSW 8 122890180 missense probably benign 0.02
R6582:Ankrd11 UTSW 8 122891629 missense probably benign 0.00
R6738:Ankrd11 UTSW 8 122891921 missense probably damaging 0.99
R6865:Ankrd11 UTSW 8 122894944 missense probably benign 0.41
R6913:Ankrd11 UTSW 8 122894911 missense probably benign 0.01
R7101:Ankrd11 UTSW 8 122895455 missense probably benign 0.35
R7116:Ankrd11 UTSW 8 122896130 missense probably damaging 1.00
R7477:Ankrd11 UTSW 8 122894385 missense possibly damaging 0.91
R7534:Ankrd11 UTSW 8 122894410 missense probably damaging 1.00
R7555:Ankrd11 UTSW 8 122887406 missense probably damaging 0.99
R7627:Ankrd11 UTSW 8 122890951 missense possibly damaging 0.63
R7658:Ankrd11 UTSW 8 122893664 missense probably benign
R7721:Ankrd11 UTSW 8 122894759 missense probably damaging 1.00
R7731:Ankrd11 UTSW 8 122895433 missense probably benign 0.12
R7792:Ankrd11 UTSW 8 122884231 missense probably damaging 0.97
R7924:Ankrd11 UTSW 8 122895902 missense possibly damaging 0.95
R7939:Ankrd11 UTSW 8 122891073 missense probably damaging 1.00
R8022:Ankrd11 UTSW 8 122887593 missense probably damaging 1.00
R8222:Ankrd11 UTSW 8 122895608 missense probably damaging 0.98
R8362:Ankrd11 UTSW 8 122892058 missense probably damaging 0.96
R8430:Ankrd11 UTSW 8 122893366 missense probably benign 0.01
R8511:Ankrd11 UTSW 8 122899729 missense
RF019:Ankrd11 UTSW 8 122896634 missense probably damaging 1.00
Z1176:Ankrd11 UTSW 8 122895803 missense possibly damaging 0.68
Z1177:Ankrd11 UTSW 8 122900142 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTAGAAGACTCTCGTGCCTTAC -3'
(R):5'- CAGCTCCGTCGATGGCAATAAC -3'

Sequencing Primer
(F):5'- CCTTACTACCAGGGAGCATTGTG -3'
(R):5'- ACTCTGAGTTTGAGAAAGGCCTC -3'
Posted On2020-08-01