Incidental Mutation 'BB011:Ick'
ID642653
Institutional Source Beutler Lab
Gene Symbol Ick
Ensembl Gene ENSMUSG00000009828
Gene Nameintestinal cell kinase
Synonyms2210420N10Rik
Accession Numbers

Genbank: NM_001163780, NM_019987

Is this an essential gene? Probably essential (E-score: 0.776) question?
Stock #BB011
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location78109192-78172107 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 78155464 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 260 (L260P)
Ref Sequence ENSEMBL: ENSMUSP00000048234 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044551] [ENSMUST00000117330] [ENSMUST00000118869]
Predicted Effect probably damaging
Transcript: ENSMUST00000044551
AA Change: L260P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048234
Gene: ENSMUSG00000009828
AA Change: L260P

DomainStartEndE-ValueType
S_TKc 4 284 2.7e-102 SMART
low complexity region 310 327 N/A INTRINSIC
low complexity region 331 344 N/A INTRINSIC
low complexity region 413 422 N/A INTRINSIC
low complexity region 457 471 N/A INTRINSIC
low complexity region 513 551 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117330
AA Change: L260P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113655
Gene: ENSMUSG00000009828
AA Change: L260P

DomainStartEndE-ValueType
S_TKc 4 284 2.7e-102 SMART
low complexity region 310 327 N/A INTRINSIC
low complexity region 331 344 N/A INTRINSIC
low complexity region 413 422 N/A INTRINSIC
low complexity region 457 471 N/A INTRINSIC
low complexity region 513 539 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118869
AA Change: L260P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112961
Gene: ENSMUSG00000009828
AA Change: L260P

DomainStartEndE-ValueType
S_TKc 4 284 2.7e-102 SMART
low complexity region 310 327 N/A INTRINSIC
low complexity region 331 344 N/A INTRINSIC
low complexity region 413 422 N/A INTRINSIC
low complexity region 457 471 N/A INTRINSIC
low complexity region 513 551 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Eukaryotic protein kinases are enzymes that belong to a very extensive family of proteins which share a conserved catalytic core common with both serine/threonine and tyrosine protein kinases. This gene encodes an intestinal serine/threonine kinase harboring a dual phosphorylation site found in mitogen-activating protein (MAP) kinases. The protein localizes to the intestinal crypt region and is thought to be important in intestinal epithelial cell proliferation and differentiation. Alternative splicing has been observed at this locus and two variants, encoding the same isoform, have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal primary cilium morphology and Shh signaling during limb digit patterning, peripheral edema, cleft palate, hydrocephalus, polydactyly, delayed skeletal development, and embryonic lethality at late stages of gestation. [provided by MGI curators]
Allele List at MGI

All alleles(29) : Targeted, other(1) Gene trapped(28)

Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930435E12Rik G A 16: 38,812,464 Q369* probably null Het
Acacb A G 5: 114,245,220 K2155E possibly damaging Het
Adgre5 G A 8: 83,729,400 P256S possibly damaging Het
Adipor1 T A 1: 134,425,993 V172D probably damaging Het
Ahsa1 T C 12: 87,270,456 probably null Het
Ankrd11 T C 8: 122,895,902 I404V possibly damaging Het
Asxl3 G A 18: 22,525,545 R2204Q probably damaging Het
Barhl2 A G 5: 106,457,649 S65P unknown Het
Bbx A T 16: 50,224,308 L630H probably damaging Het
Cars T C 7: 143,569,871 T531A possibly damaging Het
Catsperb T A 12: 101,520,565 H450Q probably benign Het
Cdt1 T C 8: 122,569,352 L135P probably damaging Het
Cfap206 T A 4: 34,728,833 H24L probably benign Het
Cnga4 T A 7: 105,407,821 V480E probably benign Het
Cnot1 ACG A 8: 95,745,647 probably null Het
Ctcfl G A 2: 173,113,656 T271I possibly damaging Het
Dlc1 T C 8: 36,571,416 R1003G probably benign Het
Dnah7b A G 1: 46,219,430 D1927G probably benign Het
Dscc1 A T 15: 55,082,176 D374E probably benign Het
Eci2 G A 13: 34,993,070 Q69* probably null Het
Ep300 C A 15: 81,649,502 P1920Q unknown Het
Epha5 A G 5: 84,084,846 Y629H possibly damaging Het
Fam208b A T 13: 3,594,331 F129Y possibly damaging Het
Fat2 G A 11: 55,262,787 T3533I probably benign Het
Fat3 T C 9: 15,999,297 N1803S probably damaging Het
Fcrls T C 3: 87,259,533 Y51C probably damaging Het
G530012D18Rik C G 1: 85,577,214 D113E unknown Het
Gcnt2 A T 13: 40,918,564 K228* probably null Het
Gucy2c A T 6: 136,763,055 V258E probably benign Het
Hecw1 C A 13: 14,322,528 L298F probably damaging Het
Hydin T G 8: 110,418,471 V818G possibly damaging Het
Hykk A G 9: 54,922,240 Y131C probably damaging Het
Mpo A G 11: 87,794,840 D48G probably damaging Het
Mrps10 T C 17: 47,378,283 *202Q probably null Het
Mrps14 T C 1: 160,196,989 V30A probably benign Het
Mtmr7 G A 8: 40,606,884 A62V possibly damaging Het
Muc2 G T 7: 141,695,388 G497W probably damaging Het
Nnt A T 13: 119,386,645 V237D probably damaging Het
Nox4 G T 7: 87,374,381 V492L probably benign Het
Obscn C G 11: 59,112,555 E1306Q probably benign Het
Olfr303 A G 7: 86,394,730 I256T probably damaging Het
Olfr993 T C 2: 85,414,219 Y220C probably benign Het
Pard3 A G 8: 127,410,750 N861S probably benign Het
Pdlim4 G A 11: 54,055,222 R230* probably null Het
Pinlyp C T 7: 24,542,125 V159M possibly damaging Het
Plcb1 A T 2: 135,359,693 T855S probably benign Het
Pot1a T A 6: 25,753,310 D409V possibly damaging Het
Prom1 T C 5: 44,029,769 D382G probably benign Het
Prss16 A T 13: 22,008,664 N83K probably damaging Het
Ptprn2 A G 12: 116,841,264 D133G probably benign Het
Rasef C T 4: 73,740,929 probably null Het
Rbak A G 5: 143,174,486 S271P probably damaging Het
Rbm20 A T 19: 53,677,585 I60F possibly damaging Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Rsf1 G GACGGCCGCC 7: 97,579,909 probably benign Het
Serpinb3c A G 1: 107,273,174 L171P probably damaging Het
Slc25a19 T C 11: 115,615,550 Y211C unknown Het
Sorbs2 C T 8: 45,795,470 S586L probably damaging Het
Spesp1 A T 9: 62,273,451 S58R probably benign Het
Spryd3 A G 15: 102,118,327 I329T probably benign Het
St8sia2 G A 7: 73,966,952 L113F probably damaging Het
Star T C 8: 25,809,855 I75T possibly damaging Het
Tdrd6 T A 17: 43,627,806 I784F possibly damaging Het
Tsc22d4 A G 5: 137,768,011 I144V unknown Het
Tspan8 T C 10: 115,833,324 probably null Het
Ttll9 C T 2: 152,962,487 probably benign Het
Ubr4 T G 4: 139,467,276 L1160R unknown Het
Ufd1 A G 16: 18,823,285 Y162C possibly damaging Het
Unc13c A T 9: 73,734,408 F1268I probably benign Het
Uvssa T C 5: 33,410,951 I561T probably damaging Het
Vmn2r15 A T 5: 109,286,388 S817T probably damaging Het
Ybx1 T C 4: 119,282,279 E173G probably damaging Het
Zc3h6 T C 2: 129,015,480 S640P possibly damaging Het
Other mutations in Ick
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Ick APN 9 78164539 missense probably benign 0.00
IGL01679:Ick APN 9 78140025 missense possibly damaging 0.94
IGL02525:Ick APN 9 78160393 missense probably benign 0.37
IGL02719:Ick APN 9 78140019 missense probably damaging 0.99
BB001:Ick UTSW 9 78155464 missense probably damaging 1.00
H8930:Ick UTSW 9 78150619 missense possibly damaging 0.92
R0471:Ick UTSW 9 78155517 critical splice donor site probably null
R1626:Ick UTSW 9 78150637 missense probably damaging 1.00
R1824:Ick UTSW 9 78157862 missense probably benign
R2186:Ick UTSW 9 78131487 missense probably benign 0.07
R2872:Ick UTSW 9 78140100 splice site probably null
R2872:Ick UTSW 9 78140100 splice site probably null
R4609:Ick UTSW 9 78167789 utr 3 prime probably benign
R4737:Ick UTSW 9 78150654 missense probably damaging 1.00
R4792:Ick UTSW 9 78153693 missense probably damaging 1.00
R5001:Ick UTSW 9 78131519 missense probably damaging 1.00
R5060:Ick UTSW 9 78153696 missense probably benign 0.01
R5093:Ick UTSW 9 78140021 missense probably benign 0.24
R5393:Ick UTSW 9 78160715 missense probably benign
R6199:Ick UTSW 9 78164639 missense probably benign 0.04
R6412:Ick UTSW 9 78139976 missense probably damaging 1.00
R7038:Ick UTSW 9 78109202 unclassified probably benign
R7468:Ick UTSW 9 78157939 missense probably benign 0.00
R7660:Ick UTSW 9 78167620 missense probably benign
R7661:Ick UTSW 9 78167620 missense probably benign
R7662:Ick UTSW 9 78167620 missense probably benign
R7666:Ick UTSW 9 78167620 missense probably benign
R7693:Ick UTSW 9 78157726 missense probably benign
R7783:Ick UTSW 9 78135645 missense probably damaging 0.97
R7787:Ick UTSW 9 78167620 missense probably benign
R7788:Ick UTSW 9 78167620 missense probably benign
R7924:Ick UTSW 9 78155464 missense probably damaging 1.00
R8317:Ick UTSW 9 78153651 missense probably damaging 0.98
X0067:Ick UTSW 9 78155403 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACAGTTGCCTTTCTGTGACGG -3'
(R):5'- CTCCAGTTCAGAGCAGTCAATAC -3'

Sequencing Primer
(F):5'- TGACGGGCACACAGAAGACC -3'
(R):5'- AGAGCAGTCAATACTATTTTTCAACC -3'
Posted On2020-08-01