Incidental Mutation 'BB011:Slc25a19'
ID642659
Institutional Source Beutler Lab
Gene Symbol Slc25a19
Ensembl Gene ENSMUSG00000020744
Gene Namesolute carrier family 25 (mitochondrial thiamine pyrophosphate carrier), member 19
Synonyms2900089E13Rik, DNC, MUP1, TPC
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #BB011
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location115614178-115628295 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 115615550 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 211 (Y211C)
Ref Sequence ENSEMBL: ENSMUSP00000102112 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021087] [ENSMUST00000021089] [ENSMUST00000106503] [ENSMUST00000106506] [ENSMUST00000106507] [ENSMUST00000135552] [ENSMUST00000148574] [ENSMUST00000178003]
Predicted Effect probably benign
Transcript: ENSMUST00000021087
SMART Domains Protein: ENSMUSP00000021087
Gene: ENSMUSG00000020743

DomainStartEndE-ValueType
Pfam:MIF4G 4 205 1.4e-14 PFAM
Predicted Effect silent
Transcript: ENSMUST00000021089
SMART Domains Protein: ENSMUSP00000021089
Gene: ENSMUSG00000020744

DomainStartEndE-ValueType
Pfam:Mito_carr 12 111 5.7e-20 PFAM
Pfam:Mito_carr 114 205 5.3e-24 PFAM
Pfam:Mito_carr 212 313 5.2e-23 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000106503
AA Change: Y211C
SMART Domains Protein: ENSMUSP00000102112
Gene: ENSMUSG00000020744
AA Change: Y211C

DomainStartEndE-ValueType
Pfam:Mito_carr 11 111 1.7e-22 PFAM
Pfam:Mito_carr 114 172 9.7e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106506
SMART Domains Protein: ENSMUSP00000102115
Gene: ENSMUSG00000020743

DomainStartEndE-ValueType
Pfam:MIF4G 4 186 1.1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106507
SMART Domains Protein: ENSMUSP00000102116
Gene: ENSMUSG00000020743

DomainStartEndE-ValueType
Pfam:MIF4G 4 204 3.5e-15 PFAM
Predicted Effect silent
Transcript: ENSMUST00000135552
SMART Domains Protein: ENSMUSP00000114566
Gene: ENSMUSG00000020744

DomainStartEndE-ValueType
Pfam:Mito_carr 31 122 1.1e-25 PFAM
Pfam:Mito_carr 129 226 4.7e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148574
SMART Domains Protein: ENSMUSP00000119643
Gene: ENSMUSG00000020743

DomainStartEndE-ValueType
Pfam:MIF4G 4 162 1.3e-7 PFAM
Predicted Effect silent
Transcript: ENSMUST00000178003
SMART Domains Protein: ENSMUSP00000137534
Gene: ENSMUSG00000020744

DomainStartEndE-ValueType
Pfam:Mito_carr 11 111 1.1e-21 PFAM
Pfam:Mito_carr 114 205 7e-25 PFAM
Pfam:Mito_carr 212 313 1e-24 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial protein that is a member of the solute carrier family. Although this protein was initially thought to be the mitochondrial deoxynucleotide carrier involved in the uptake of deoxynucleotides into the matrix of the mitochondria, further studies have demonstrated that this protein instead functions as the mitochondrial thiamine pyrophosphate carrier, which transports thiamine pyrophosphates into mitochondria. Mutations in this gene cause microcephaly, Amish type, a metabolic disease that results in severe congenital microcephaly, severe 2-ketoglutaric aciduria, and death within the first year. Multiple alternatively spliced variants, encoding the same protein, have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in lethality by E12, neural tube closure defects resulting in exencephaly and microcephaly, growth arrest, anemia, elevated alpha-ketoglutarate in amniotic fluid, and reduced thiamine pyrophosphate content in mitochondria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930435E12Rik G A 16: 38,812,464 Q369* probably null Het
Acacb A G 5: 114,245,220 K2155E possibly damaging Het
Adgre5 G A 8: 83,729,400 P256S possibly damaging Het
Adipor1 T A 1: 134,425,993 V172D probably damaging Het
Ahsa1 T C 12: 87,270,456 probably null Het
Ankrd11 T C 8: 122,895,902 I404V possibly damaging Het
Asxl3 G A 18: 22,525,545 R2204Q probably damaging Het
Barhl2 A G 5: 106,457,649 S65P unknown Het
Bbx A T 16: 50,224,308 L630H probably damaging Het
Cars T C 7: 143,569,871 T531A possibly damaging Het
Catsperb T A 12: 101,520,565 H450Q probably benign Het
Cdt1 T C 8: 122,569,352 L135P probably damaging Het
Cfap206 T A 4: 34,728,833 H24L probably benign Het
Cnga4 T A 7: 105,407,821 V480E probably benign Het
Cnot1 ACG A 8: 95,745,647 probably null Het
Ctcfl G A 2: 173,113,656 T271I possibly damaging Het
Dlc1 T C 8: 36,571,416 R1003G probably benign Het
Dnah7b A G 1: 46,219,430 D1927G probably benign Het
Dscc1 A T 15: 55,082,176 D374E probably benign Het
Eci2 G A 13: 34,993,070 Q69* probably null Het
Ep300 C A 15: 81,649,502 P1920Q unknown Het
Epha5 A G 5: 84,084,846 Y629H possibly damaging Het
Fam208b A T 13: 3,594,331 F129Y possibly damaging Het
Fat2 G A 11: 55,262,787 T3533I probably benign Het
Fat3 T C 9: 15,999,297 N1803S probably damaging Het
Fcrls T C 3: 87,259,533 Y51C probably damaging Het
G530012D18Rik C G 1: 85,577,214 D113E unknown Het
Gcnt2 A T 13: 40,918,564 K228* probably null Het
Gucy2c A T 6: 136,763,055 V258E probably benign Het
Hecw1 C A 13: 14,322,528 L298F probably damaging Het
Hydin T G 8: 110,418,471 V818G possibly damaging Het
Hykk A G 9: 54,922,240 Y131C probably damaging Het
Ick T C 9: 78,155,464 L260P probably damaging Het
Mpo A G 11: 87,794,840 D48G probably damaging Het
Mrps10 T C 17: 47,378,283 *202Q probably null Het
Mrps14 T C 1: 160,196,989 V30A probably benign Het
Mtmr7 G A 8: 40,606,884 A62V possibly damaging Het
Muc2 G T 7: 141,695,388 G497W probably damaging Het
Nnt A T 13: 119,386,645 V237D probably damaging Het
Nox4 G T 7: 87,374,381 V492L probably benign Het
Obscn C G 11: 59,112,555 E1306Q probably benign Het
Olfr303 A G 7: 86,394,730 I256T probably damaging Het
Olfr993 T C 2: 85,414,219 Y220C probably benign Het
Pard3 A G 8: 127,410,750 N861S probably benign Het
Pdlim4 G A 11: 54,055,222 R230* probably null Het
Pinlyp C T 7: 24,542,125 V159M possibly damaging Het
Plcb1 A T 2: 135,359,693 T855S probably benign Het
Pot1a T A 6: 25,753,310 D409V possibly damaging Het
Prom1 T C 5: 44,029,769 D382G probably benign Het
Prss16 A T 13: 22,008,664 N83K probably damaging Het
Ptprn2 A G 12: 116,841,264 D133G probably benign Het
Rasef C T 4: 73,740,929 probably null Het
Rbak A G 5: 143,174,486 S271P probably damaging Het
Rbm20 A T 19: 53,677,585 I60F possibly damaging Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Rsf1 G GACGGCCGCC 7: 97,579,909 probably benign Het
Serpinb3c A G 1: 107,273,174 L171P probably damaging Het
Sorbs2 C T 8: 45,795,470 S586L probably damaging Het
Spesp1 A T 9: 62,273,451 S58R probably benign Het
Spryd3 A G 15: 102,118,327 I329T probably benign Het
St8sia2 G A 7: 73,966,952 L113F probably damaging Het
Star T C 8: 25,809,855 I75T possibly damaging Het
Tdrd6 T A 17: 43,627,806 I784F possibly damaging Het
Tsc22d4 A G 5: 137,768,011 I144V unknown Het
Tspan8 T C 10: 115,833,324 probably null Het
Ttll9 C T 2: 152,962,487 probably benign Het
Ubr4 T G 4: 139,467,276 L1160R unknown Het
Ufd1 A G 16: 18,823,285 Y162C possibly damaging Het
Unc13c A T 9: 73,734,408 F1268I probably benign Het
Uvssa T C 5: 33,410,951 I561T probably damaging Het
Vmn2r15 A T 5: 109,286,388 S817T probably damaging Het
Ybx1 T C 4: 119,282,279 E173G probably damaging Het
Zc3h6 T C 2: 129,015,480 S640P possibly damaging Het
Other mutations in Slc25a19
AlleleSourceChrCoordTypePredicted EffectPPH Score
Baggins UTSW 11 115617560 missense possibly damaging 0.91
rings UTSW 11 115615551 missense probably benign 0.14
BB001:Slc25a19 UTSW 11 115615550 missense unknown
PIT4498001:Slc25a19 UTSW 11 115623955 missense possibly damaging 0.80
R0335:Slc25a19 UTSW 11 115624206 missense probably damaging 1.00
R0398:Slc25a19 UTSW 11 115617575 missense probably damaging 1.00
R0454:Slc25a19 UTSW 11 115617597 nonsense probably null
R1614:Slc25a19 UTSW 11 115616623 nonsense probably null
R3775:Slc25a19 UTSW 11 115615459 missense probably damaging 1.00
R3776:Slc25a19 UTSW 11 115615459 missense probably damaging 1.00
R5000:Slc25a19 UTSW 11 115616671 splice site probably null
R5593:Slc25a19 UTSW 11 115616592 missense probably damaging 1.00
R5738:Slc25a19 UTSW 11 115624234 missense probably benign 0.24
R6167:Slc25a19 UTSW 11 115615551 missense probably benign 0.14
R6306:Slc25a19 UTSW 11 115617560 missense possibly damaging 0.91
R7014:Slc25a19 UTSW 11 115620966 missense probably damaging 1.00
R7161:Slc25a19 UTSW 11 115616547 missense possibly damaging 0.66
R7924:Slc25a19 UTSW 11 115615550 missense unknown
Predicted Primers PCR Primer
(F):5'- TATGAGCTCAGAGCCAAGTCTTG -3'
(R):5'- CCTTCCTCAGTTAGCAGCATGC -3'

Sequencing Primer
(F):5'- TCAGAGCCAAGTCTTGTCGGG -3'
(R):5'- CATTAGAAAGAGTGAGGAGCTCCC -3'
Posted On2020-08-01