Incidental Mutation 'BB011:Ptprn2'
ID 642662
Institutional Source Beutler Lab
Gene Symbol Ptprn2
Ensembl Gene ENSMUSG00000056553
Gene Name protein tyrosine phosphatase receptor type N polypeptide 2
Synonyms IA-2 beta, PTP-NP, 4930425H11Rik, IA-2beta, phogrin
Accession Numbers
Essential gene? Probably non essential (E-score: 0.170) question?
Stock # BB011
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 116449340-117240469 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 116804884 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 133 (D133G)
Ref Sequence ENSEMBL: ENSMUSP00000064046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070733] [ENSMUST00000190247]
AlphaFold P80560
Predicted Effect probably benign
Transcript: ENSMUST00000070733
AA Change: D133G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000064046
Gene: ENSMUSG00000056553
AA Change: D133G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
RESP18 58 157 1.9e-40 SMART
low complexity region 393 426 N/A INTRINSIC
Pfam:Receptor_IA-2 495 583 1.5e-35 PFAM
low complexity region 687 707 N/A INTRINSIC
PTPc 730 993 4.42e-119 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190247
AA Change: D133G

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000139978
Gene: ENSMUSG00000056553
AA Change: D133G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
RESP18 58 157 1.9e-40 SMART
low complexity region 393 426 N/A INTRINSIC
Pfam:Receptor_IA-2 494 584 2.5e-43 PFAM
transmembrane domain 602 624 N/A INTRINSIC
low complexity region 687 707 N/A INTRINSIC
PTPc 730 932 8.81e-64 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with sequence similarity to receptor-like protein tyrosine phosphatases. However, tyrosine phosphatase activity has not been experimentally validated for this protein. Studies of the rat ortholog suggest that the encoded protein may instead function as a phosphatidylinositol phosphatase with the ability to dephosphorylate phosphatidylinositol 3-phosphate and phosphatidylinositol 4,5-diphosphate, and this function may be involved in the regulation of insulin secretion. This protein has been identified as an autoantigen in insulin-dependent diabetes mellitus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
PHENOTYPE: Homozygous null mice display impaired glucose tolerance but normal fasting and non-fasting blood glucose and insulin levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb A G 5: 114,383,281 (GRCm39) K2155E possibly damaging Het
Adgre5 G A 8: 84,456,029 (GRCm39) P256S possibly damaging Het
Adipor1 T A 1: 134,353,731 (GRCm39) V172D probably damaging Het
Ahsa1 T C 12: 87,317,230 (GRCm39) probably null Het
Ankrd11 T C 8: 123,622,641 (GRCm39) I404V possibly damaging Het
Asxl3 G A 18: 22,658,602 (GRCm39) R2204Q probably damaging Het
Barhl2 A G 5: 106,605,515 (GRCm39) S65P unknown Het
Bbx A T 16: 50,044,671 (GRCm39) L630H probably damaging Het
Cars1 T C 7: 143,123,608 (GRCm39) T531A possibly damaging Het
Catsperb T A 12: 101,486,824 (GRCm39) H450Q probably benign Het
Cdt1 T C 8: 123,296,091 (GRCm39) L135P probably damaging Het
Cfap206 T A 4: 34,728,833 (GRCm39) H24L probably benign Het
Cilk1 T C 9: 78,062,746 (GRCm39) L260P probably damaging Het
Cnga4 T A 7: 105,057,028 (GRCm39) V480E probably benign Het
Cnot1 ACG A 8: 96,472,275 (GRCm39) probably null Het
Ctcfl G A 2: 172,955,449 (GRCm39) T271I possibly damaging Het
Dlc1 T C 8: 37,038,570 (GRCm39) R1003G probably benign Het
Dnah7b A G 1: 46,258,590 (GRCm39) D1927G probably benign Het
Dscc1 A T 15: 54,945,572 (GRCm39) D374E probably benign Het
Eci2 G A 13: 35,177,053 (GRCm39) Q69* probably null Het
Ep300 C A 15: 81,533,703 (GRCm39) P1920Q unknown Het
Epha5 A G 5: 84,232,705 (GRCm39) Y629H possibly damaging Het
Fat2 G A 11: 55,153,613 (GRCm39) T3533I probably benign Het
Fat3 T C 9: 15,910,593 (GRCm39) N1803S probably damaging Het
Fcrl2 T C 3: 87,166,840 (GRCm39) Y51C probably damaging Het
G530012D18Rik C G 1: 85,504,935 (GRCm39) D113E unknown Het
Gcnt2 A T 13: 41,072,040 (GRCm39) K228* probably null Het
Gucy2c A T 6: 136,740,053 (GRCm39) V258E probably benign Het
Hecw1 C A 13: 14,497,113 (GRCm39) L298F probably damaging Het
Hydin T G 8: 111,145,103 (GRCm39) V818G possibly damaging Het
Hykk A G 9: 54,829,524 (GRCm39) Y131C probably damaging Het
Mpo A G 11: 87,685,666 (GRCm39) D48G probably damaging Het
Mrps10 T C 17: 47,689,208 (GRCm39) *202Q probably null Het
Mrps14 T C 1: 160,024,559 (GRCm39) V30A probably benign Het
Mtmr7 G A 8: 41,059,927 (GRCm39) A62V possibly damaging Het
Muc2 G T 7: 141,281,631 (GRCm39) G497W probably damaging Het
Nnt A T 13: 119,523,181 (GRCm39) V237D probably damaging Het
Nox4 G T 7: 87,023,589 (GRCm39) V492L probably benign Het
Obscn C G 11: 59,003,381 (GRCm39) E1306Q probably benign Het
Or5ak23 T C 2: 85,244,563 (GRCm39) Y220C probably benign Het
Or6aa1 A G 7: 86,043,938 (GRCm39) I256T probably damaging Het
Pard3 A G 8: 128,137,231 (GRCm39) N861S probably benign Het
Pdlim4 G A 11: 53,946,048 (GRCm39) R230* probably null Het
Pinlyp C T 7: 24,241,550 (GRCm39) V159M possibly damaging Het
Plcb1 A T 2: 135,201,613 (GRCm39) T855S probably benign Het
Pot1a T A 6: 25,753,309 (GRCm39) D409V possibly damaging Het
Prom1 T C 5: 44,187,111 (GRCm39) D382G probably benign Het
Prss16 A T 13: 22,192,834 (GRCm39) N83K probably damaging Het
Rasef C T 4: 73,659,166 (GRCm39) probably null Het
Rbak A G 5: 143,160,241 (GRCm39) S271P probably damaging Het
Rbm20 A T 19: 53,666,016 (GRCm39) I60F possibly damaging Het
Rftn1 G T 17: 50,354,408 (GRCm39) A318D probably damaging Het
Rsf1 G GACGGCCGCC 7: 97,229,116 (GRCm39) probably benign Het
Serpinb3c A G 1: 107,200,904 (GRCm39) L171P probably damaging Het
Slc25a19 T C 11: 115,506,376 (GRCm39) Y211C unknown Het
Sorbs2 C T 8: 46,248,507 (GRCm39) S586L probably damaging Het
Spesp1 A T 9: 62,180,733 (GRCm39) S58R probably benign Het
Spryd3 A G 15: 102,026,762 (GRCm39) I329T probably benign Het
St8sia2 G A 7: 73,616,700 (GRCm39) L113F probably damaging Het
Star T C 8: 26,299,883 (GRCm39) I75T possibly damaging Het
Tasor2 A T 13: 3,644,331 (GRCm39) F129Y possibly damaging Het
Tdrd6 T A 17: 43,938,697 (GRCm39) I784F possibly damaging Het
Tex55 G A 16: 38,632,826 (GRCm39) Q369* probably null Het
Tsc22d4 A G 5: 137,766,273 (GRCm39) I144V unknown Het
Tspan8 T C 10: 115,669,229 (GRCm39) probably null Het
Ttll9 C T 2: 152,804,407 (GRCm39) probably benign Het
Ubr4 T G 4: 139,194,587 (GRCm39) L1160R unknown Het
Ufd1 A G 16: 18,642,035 (GRCm39) Y162C possibly damaging Het
Unc13c A T 9: 73,641,690 (GRCm39) F1268I probably benign Het
Uvssa T C 5: 33,568,295 (GRCm39) I561T probably damaging Het
Vmn2r15 A T 5: 109,434,254 (GRCm39) S817T probably damaging Het
Ybx1 T C 4: 119,139,476 (GRCm39) E173G probably damaging Het
Zc3h6 T C 2: 128,857,400 (GRCm39) S640P possibly damaging Het
Other mutations in Ptprn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01695:Ptprn2 APN 12 116,805,008 (GRCm39) missense probably benign 0.02
IGL01788:Ptprn2 APN 12 116,864,607 (GRCm39) missense probably damaging 0.98
IGL02172:Ptprn2 APN 12 116,837,317 (GRCm39) splice site probably benign
IGL02339:Ptprn2 APN 12 116,685,724 (GRCm39) missense probably damaging 1.00
IGL02706:Ptprn2 APN 12 116,852,518 (GRCm39) missense probably damaging 0.96
IGL03018:Ptprn2 APN 12 117,175,563 (GRCm39) missense probably damaging 1.00
IGL03267:Ptprn2 APN 12 116,839,964 (GRCm39) nonsense probably null
BB001:Ptprn2 UTSW 12 116,804,884 (GRCm39) missense probably benign 0.00
IGL03014:Ptprn2 UTSW 12 117,212,308 (GRCm39) missense probably damaging 1.00
R0066:Ptprn2 UTSW 12 117,240,222 (GRCm39) missense probably benign 0.07
R0066:Ptprn2 UTSW 12 117,240,222 (GRCm39) missense probably benign 0.07
R0115:Ptprn2 UTSW 12 117,175,466 (GRCm39) splice site probably benign
R0131:Ptprn2 UTSW 12 116,685,711 (GRCm39) missense probably damaging 1.00
R0131:Ptprn2 UTSW 12 116,685,711 (GRCm39) missense probably damaging 1.00
R0132:Ptprn2 UTSW 12 116,685,711 (GRCm39) missense probably damaging 1.00
R0481:Ptprn2 UTSW 12 117,175,466 (GRCm39) splice site probably benign
R0694:Ptprn2 UTSW 12 116,787,975 (GRCm39) missense possibly damaging 0.69
R0698:Ptprn2 UTSW 12 116,685,750 (GRCm39) nonsense probably null
R0746:Ptprn2 UTSW 12 116,864,637 (GRCm39) missense probably benign 0.00
R1127:Ptprn2 UTSW 12 117,175,628 (GRCm39) splice site probably null
R1443:Ptprn2 UTSW 12 117,217,235 (GRCm39) missense probably damaging 1.00
R1508:Ptprn2 UTSW 12 117,148,342 (GRCm39) missense probably damaging 1.00
R1664:Ptprn2 UTSW 12 117,125,329 (GRCm39) missense probably damaging 0.99
R1670:Ptprn2 UTSW 12 116,685,792 (GRCm39) missense possibly damaging 0.64
R1749:Ptprn2 UTSW 12 116,544,048 (GRCm39) missense probably benign 0.00
R2075:Ptprn2 UTSW 12 117,211,337 (GRCm39) missense probably benign 0.01
R3054:Ptprn2 UTSW 12 116,685,753 (GRCm39) missense probably damaging 1.00
R3107:Ptprn2 UTSW 12 116,839,800 (GRCm39) missense probably benign 0.04
R3109:Ptprn2 UTSW 12 116,839,800 (GRCm39) missense probably benign 0.04
R3552:Ptprn2 UTSW 12 116,852,497 (GRCm39) missense probably benign 0.00
R4193:Ptprn2 UTSW 12 116,864,628 (GRCm39) missense probably benign 0.01
R4523:Ptprn2 UTSW 12 116,839,620 (GRCm39) missense probably damaging 1.00
R4706:Ptprn2 UTSW 12 116,835,714 (GRCm39) missense probably benign 0.02
R4719:Ptprn2 UTSW 12 116,788,016 (GRCm39) missense possibly damaging 0.95
R4726:Ptprn2 UTSW 12 117,211,393 (GRCm39) nonsense probably null
R4872:Ptprn2 UTSW 12 117,125,314 (GRCm39) missense probably damaging 1.00
R4891:Ptprn2 UTSW 12 117,196,985 (GRCm39) splice site probably null
R4970:Ptprn2 UTSW 12 117,240,215 (GRCm39) missense probably damaging 1.00
R5208:Ptprn2 UTSW 12 116,822,548 (GRCm39) missense probably damaging 1.00
R5287:Ptprn2 UTSW 12 117,175,482 (GRCm39) missense probably damaging 1.00
R5419:Ptprn2 UTSW 12 117,148,267 (GRCm39) missense probably damaging 0.99
R6035:Ptprn2 UTSW 12 117,219,215 (GRCm39) missense probably damaging 1.00
R6035:Ptprn2 UTSW 12 117,219,215 (GRCm39) missense probably damaging 1.00
R6180:Ptprn2 UTSW 12 116,822,739 (GRCm39) missense probably benign 0.05
R6277:Ptprn2 UTSW 12 116,839,800 (GRCm39) missense probably benign 0.04
R6465:Ptprn2 UTSW 12 117,233,209 (GRCm39) missense probably damaging 0.96
R6488:Ptprn2 UTSW 12 116,835,658 (GRCm39) missense probably benign 0.13
R6555:Ptprn2 UTSW 12 117,190,820 (GRCm39) missense probably damaging 1.00
R6908:Ptprn2 UTSW 12 116,852,508 (GRCm39) missense probably benign 0.06
R7120:Ptprn2 UTSW 12 116,835,676 (GRCm39) missense probably benign 0.01
R7229:Ptprn2 UTSW 12 117,190,845 (GRCm39) splice site probably null
R7237:Ptprn2 UTSW 12 117,125,347 (GRCm39) missense probably benign 0.03
R7304:Ptprn2 UTSW 12 117,212,164 (GRCm39) missense probably damaging 1.00
R7355:Ptprn2 UTSW 12 116,822,571 (GRCm39) missense probably benign
R7460:Ptprn2 UTSW 12 117,212,301 (GRCm39) missense probably benign 0.05
R7577:Ptprn2 UTSW 12 116,449,486 (GRCm39) start codon destroyed probably null
R7658:Ptprn2 UTSW 12 116,685,739 (GRCm39) missense probably benign 0.01
R7666:Ptprn2 UTSW 12 116,804,940 (GRCm39) missense probably benign 0.10
R7924:Ptprn2 UTSW 12 116,804,884 (GRCm39) missense probably benign 0.00
R8219:Ptprn2 UTSW 12 117,148,357 (GRCm39) missense probably benign 0.30
R8716:Ptprn2 UTSW 12 117,219,168 (GRCm39) missense possibly damaging 0.73
R9235:Ptprn2 UTSW 12 117,233,271 (GRCm39) critical splice donor site probably null
R9605:Ptprn2 UTSW 12 117,125,278 (GRCm39) missense probably benign 0.13
X0066:Ptprn2 UTSW 12 117,148,360 (GRCm39) missense probably benign 0.16
X0066:Ptprn2 UTSW 12 117,125,380 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGGGAACTGTGAGTCCAG -3'
(R):5'- CTGCAAAGATGTCTGTACCCTAC -3'

Sequencing Primer
(F):5'- AACTGTGAGTCCAGGCTCCTTAAG -3'
(R):5'- GGTAAAAGACAACCCAGGCCATG -3'
Posted On 2020-08-01