Mutagenetix > Incidental Mutations

Incidental Mutation 'BB011:Rftn1'

642677

Institutional Source

Beutler Lab

Gene Symbol

Rftn1

Ensembl Gene

ENSMUSG00000039316

Gene Name

raftlin lipid raft linker 1

Synonyms

2310015N21Rik

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.063) question?

Stock #

BB011

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

49992257-50190674 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 50047380 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Aspartic acid at position 318 (A318D)

Ref Sequence

ENSEMBL: ENSMUSP00000046524 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044503] [ENSMUST00000113195]

AlphaFold

Q6A0D4

Predicted Effect

probably damaging
Transcript: ENSMUST00000044503
AA Change: A318D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000046524
Gene: ENSMUSG00000039316
AA Change: A318D

Domain	Start	End	E-Value	Type
Pfam:Raftlin	1	473	1.3e-219	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000113195
AA Change: A40D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000108820
Gene: ENSMUSG00000039316
AA Change: A40D

Domain	Start	End	E-Value	Type
Pfam:Raftlin	1	207	1.5e-104	PFAM

Meta Mutation Damage Score

0.3897

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for null mutations have defects in T cell activation, T cell help to B cells, and Th17 differentation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930435E12Rik	G	A	16: 38,812,464	Q369*	probably null	Het
Acacb	A	G	5: 114,245,220	K2155E	possibly damaging	Het
Adgre5	G	A	8: 83,729,400	P256S	possibly damaging	Het
Adipor1	T	A	1: 134,425,993	V172D	probably damaging	Het
Ahsa1	T	C	12: 87,270,456		probably null	Het
Ankrd11	T	C	8: 122,895,902	I404V	possibly damaging	Het
Asxl3	G	A	18: 22,525,545	R2204Q	probably damaging	Het
Barhl2	A	G	5: 106,457,649	S65P	unknown	Het
Bbx	A	T	16: 50,224,308	L630H	probably damaging	Het
Cars	T	C	7: 143,569,871	T531A	possibly damaging	Het
Catsperb	T	A	12: 101,520,565	H450Q	probably benign	Het
Cdt1	T	C	8: 122,569,352	L135P	probably damaging	Het
Cfap206	T	A	4: 34,728,833	H24L	probably benign	Het
Cnga4	T	A	7: 105,407,821	V480E	probably benign	Het
Cnot1	ACG	A	8: 95,745,647		probably null	Het
Ctcfl	G	A	2: 173,113,656	T271I	possibly damaging	Het
Dlc1	T	C	8: 36,571,416	R1003G	probably benign	Het
Dnah7b	A	G	1: 46,219,430	D1927G	probably benign	Het
Dscc1	A	T	15: 55,082,176	D374E	probably benign	Het
Eci2	G	A	13: 34,993,070	Q69*	probably null	Het
Ep300	C	A	15: 81,649,502	P1920Q	unknown	Het
Epha5	A	G	5: 84,084,846	Y629H	possibly damaging	Het
Fam208b	A	T	13: 3,594,331	F129Y	possibly damaging	Het
Fat2	G	A	11: 55,262,787	T3533I	probably benign	Het
Fat3	T	C	9: 15,999,297	N1803S	probably damaging	Het
Fcrls	T	C	3: 87,259,533	Y51C	probably damaging	Het
G530012D18Rik	C	G	1: 85,577,214	D113E	unknown	Het
Gcnt2	A	T	13: 40,918,564	K228*	probably null	Het
Gucy2c	A	T	6: 136,763,055	V258E	probably benign	Het
Hecw1	C	A	13: 14,322,528	L298F	probably damaging	Het
Hydin	T	G	8: 110,418,471	V818G	possibly damaging	Het
Hykk	A	G	9: 54,922,240	Y131C	probably damaging	Het
Ick	T	C	9: 78,155,464	L260P	probably damaging	Het
Mpo	A	G	11: 87,794,840	D48G	probably damaging	Het
Mrps10	T	C	17: 47,378,283	*202Q	probably null	Het
Mrps14	T	C	1: 160,196,989	V30A	probably benign	Het
Mtmr7	G	A	8: 40,606,884	A62V	possibly damaging	Het
Muc2	G	T	7: 141,695,388	G497W	probably damaging	Het
Nnt	A	T	13: 119,386,645	V237D	probably damaging	Het
Nox4	G	T	7: 87,374,381	V492L	probably benign	Het
Obscn	C	G	11: 59,112,555	E1306Q	probably benign	Het
Olfr303	A	G	7: 86,394,730	I256T	probably damaging	Het
Olfr993	T	C	2: 85,414,219	Y220C	probably benign	Het
Pard3	A	G	8: 127,410,750	N861S	probably benign	Het
Pdlim4	G	A	11: 54,055,222	R230*	probably null	Het
Pinlyp	C	T	7: 24,542,125	V159M	possibly damaging	Het
Plcb1	A	T	2: 135,359,693	T855S	probably benign	Het
Pot1a	T	A	6: 25,753,310	D409V	possibly damaging	Het
Prom1	T	C	5: 44,029,769	D382G	probably benign	Het
Prss16	A	T	13: 22,008,664	N83K	probably damaging	Het
Ptprn2	A	G	12: 116,841,264	D133G	probably benign	Het
Rasef	C	T	4: 73,740,929		probably null	Het
Rbak	A	G	5: 143,174,486	S271P	probably damaging	Het
Rbm20	A	T	19: 53,677,585	I60F	possibly damaging	Het
Rsf1	G	GACGGCCGCC	7: 97,579,909		probably benign	Het
Serpinb3c	A	G	1: 107,273,174	L171P	probably damaging	Het
Slc25a19	T	C	11: 115,615,550	Y211C	unknown	Het
Sorbs2	C	T	8: 45,795,470	S586L	probably damaging	Het
Spesp1	A	T	9: 62,273,451	S58R	probably benign	Het
Spryd3	A	G	15: 102,118,327	I329T	probably benign	Het
St8sia2	G	A	7: 73,966,952	L113F	probably damaging	Het
Star	T	C	8: 25,809,855	I75T	possibly damaging	Het
Tdrd6	T	A	17: 43,627,806	I784F	possibly damaging	Het
Tsc22d4	A	G	5: 137,768,011	I144V	unknown	Het
Tspan8	T	C	10: 115,833,324		probably null	Het
Ttll9	C	T	2: 152,962,487		probably benign	Het
Ubr4	T	G	4: 139,467,276	L1160R	unknown	Het
Ufd1	A	G	16: 18,823,285	Y162C	possibly damaging	Het
Unc13c	A	T	9: 73,734,408	F1268I	probably benign	Het
Uvssa	T	C	5: 33,410,951	I561T	probably damaging	Het
Vmn2r15	A	T	5: 109,286,388	S817T	probably damaging	Het
Ybx1	T	C	4: 119,282,279	E173G	probably damaging	Het
Zc3h6	T	C	2: 129,015,480	S640P	possibly damaging	Het

Other mutations in Rftn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00552:Rftn1	APN	17	50055377	missense	probably benign	0.01
IGL02318:Rftn1	APN	17	50036970	missense	possibly damaging	0.95
IGL02568:Rftn1	APN	17	50036999	missense	probably damaging	1.00
IGL02873:Rftn1	APN	17	50169152	utr 5 prime	probably benign
IGL02965:Rftn1	APN	17	50055252	missense	probably benign	0.32
BB001:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
BB003:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
BB004:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
BB005:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
BB013:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
BB014:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
BB015:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
R0544:Rftn1	UTSW	17	49994261	missense	possibly damaging	0.71
R2219:Rftn1	UTSW	17	50169145	start codon destroyed	probably null	1.00
R4542:Rftn1	UTSW	17	50055231	splice site	probably null
R5318:Rftn1	UTSW	17	49994458	missense	probably benign	0.09
R5605:Rftn1	UTSW	17	50047407	missense	probably damaging	1.00
R5700:Rftn1	UTSW	17	50002669	missense	probably damaging	1.00
R5853:Rftn1	UTSW	17	50047326	missense	probably damaging	1.00
R6459:Rftn1	UTSW	17	50047306	missense	probably benign	0.02
R6994:Rftn1	UTSW	17	50036991	missense	possibly damaging	0.82
R7210:Rftn1	UTSW	17	49994307	nonsense	probably null
R7283:Rftn1	UTSW	17	50047441	missense	probably damaging	1.00
R7348:Rftn1	UTSW	17	50004323	missense	probably damaging	1.00
R7444:Rftn1	UTSW	17	50047407	missense	probably damaging	1.00
R7684:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
R7685:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
R7686:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
R7881:Rftn1	UTSW	17	50047435	missense	probably benign	0.08
R7924:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
R7926:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
R7927:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
R7928:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
R7943:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
R8052:Rftn1	UTSW	17	50086579	missense	probably damaging	0.98
R8162:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
R8164:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
R8248:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
R8249:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
R8250:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
R8271:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
R8272:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
R8273:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
R8296:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
R8297:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
R8300:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
R8315:Rftn1	UTSW	17	50002637	missense	possibly damaging	0.50
R8551:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
R8552:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
R8554:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
R8555:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
R8725:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
R8736:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
R8739:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
Z1176:Rftn1	UTSW	17	50169003	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCTAGCCTTTGTGAGATCTGCC -3'
(R):5'- ATTGGTTCTGTGGGCTAACC -3'

Sequencing Primer
(F):5'- TGAGATCTGCCCAAGCTATG -3'
(R):5'- GGTTCTGTGGGCTAACCTCTCTC -3'

Posted On

2020-08-01