Incidental Mutation 'BB012:Kti12'
ID642695
Institutional Source Beutler Lab
Gene Symbol Kti12
Ensembl Gene ENSMUSG00000073775
Gene NameKTI12 homolog, chromatin associated
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #BB012
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location108847785-108849413 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 108848247 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 119 (E119D)
Ref Sequence ENSEMBL: ENSMUSP00000099799 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030296] [ENSMUST00000102738] [ENSMUST00000164855]
Predicted Effect probably benign
Transcript: ENSMUST00000030296
SMART Domains Protein: ENSMUSP00000030296
Gene: ENSMUSG00000028567

DomainStartEndE-ValueType
low complexity region 10 18 N/A INTRINSIC
Pfam:Thioredoxin_7 37 118 1.1e-19 PFAM
Pfam:Thioredoxin 41 135 1.9e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102738
AA Change: E119D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000099799
Gene: ENSMUSG00000073775
AA Change: E119D

DomainStartEndE-ValueType
Pfam:KTI12 1 347 3.3e-107 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164855
SMART Domains Protein: ENSMUSP00000128780
Gene: ENSMUSG00000090551

DomainStartEndE-ValueType
low complexity region 4 27 N/A INTRINSIC
low complexity region 47 64 N/A INTRINSIC
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik C T 7: 40,994,082 Q392* probably null Het
4933427D14Rik A C 11: 72,180,501 L473V probably benign Het
A930002H24Rik A T 17: 63,863,397 V132E unknown Het
Abcc2 A G 19: 43,807,112 I436V probably benign Het
Ahr G A 12: 35,515,068 Q103* probably null Het
Asb15 T A 6: 24,562,724 H228Q probably benign Het
Asphd1 T A 7: 126,948,456 Y225F probably damaging Het
Atp2c1 A G 9: 105,442,770 M468T possibly damaging Het
BC030499 T C 11: 78,291,623 L86P probably damaging Het
Brca1 A G 11: 101,508,146 I1540T probably benign Het
Cdh20 A T 1: 104,984,748 I576F probably damaging Het
Chst11 T A 10: 83,190,954 S72T probably damaging Het
Cldn17 T G 16: 88,506,645 K65N probably damaging Het
Cldn22 T C 8: 47,825,187 I220T probably benign Het
Coasy T G 11: 101,083,696 D229E probably benign Het
Colec10 T C 15: 54,462,371 V199A probably damaging Het
Cpn2 G T 16: 30,260,801 D27E probably damaging Het
F5 T A 1: 164,176,366 probably null Het
Fat3 C T 9: 16,031,360 V1239I possibly damaging Het
Fbxl16 A G 17: 25,816,906 N159S probably benign Het
Fhad1 A G 4: 141,954,187 I514T probably damaging Het
Fras1 A G 5: 96,781,584 K3949R probably damaging Het
Gm10800 AAAGAAAACTGAA ACAAGAAAACTGAA 2: 98,667,033 probably null Het
Grm3 T A 5: 9,589,880 E55V probably benign Het
Itgbl1 G A 14: 123,973,323 D478N possibly damaging Het
Kcnt2 T A 1: 140,354,509 Y77* probably null Het
Kdm4c T C 4: 74,404,821 S997P probably damaging Het
Lrrc28 T C 7: 67,619,109 Y71C probably damaging Het
Lrrc45 T A 11: 120,715,880 W203R probably benign Het
Lrrc66 A T 5: 73,608,492 C403S possibly damaging Het
Ly6g6e A T 17: 35,077,918 E45V probably damaging Het
Mgam C T 6: 40,759,051 T1574I probably damaging Het
Msrb2 A T 2: 19,383,280 M80L probably benign Het
Musk T A 4: 58,367,513 L592Q probably damaging Het
Nlrp4a C A 7: 26,450,586 N539K probably benign Het
Obscn C G 11: 59,112,555 E1306Q probably benign Het
Olfr1006 T C 2: 85,674,563 E196G Het
Olfr1291-ps1 A G 2: 111,499,821 S190G probably damaging Het
Olfr355 A G 2: 36,927,359 F252L possibly damaging Het
Olfr388-ps1 A G 11: 73,724,536 S163P unknown Het
Opalin T A 19: 41,063,803 *144C probably null Het
Pgam2 T A 11: 5,803,007 H196L possibly damaging Het
Pgls T C 8: 71,592,352 S46P probably damaging Het
Prrc2b A G 2: 32,204,115 E503G probably damaging Het
Prss45 T C 9: 110,841,035 L304P unknown Het
Rbm20 T A 19: 53,813,322 V87D probably damaging Het
Serpinb8 T C 1: 107,598,985 L85S probably benign Het
Sh2b2 A T 5: 136,224,261 H352Q probably benign Het
Slc6a17 T C 3: 107,495,740 I124V probably damaging Het
Smim10l1 G A 6: 133,105,582 V31M probably damaging Het
Snx10 T C 6: 51,580,321 S78P probably benign Het
Stard10 T C 7: 101,342,631 V187A probably damaging Het
Svil C A 18: 5,118,357 D2146E probably benign Het
Tsc22d4 A G 5: 137,751,365 D301G probably null Het
Ube3c T A 5: 29,646,431 I752N probably damaging Het
Wisp2 G C 2: 163,829,041 R156T possibly damaging Het
Wwc1 T C 11: 35,844,163 M962V probably benign Het
Other mutations in Kti12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02608:Kti12 APN 4 108848162 missense probably damaging 1.00
IGL02891:Kti12 APN 4 108848533 missense probably benign
IGL03142:Kti12 APN 4 108848165 missense probably damaging 1.00
BB002:Kti12 UTSW 4 108848246 missense probably benign
BB002:Kti12 UTSW 4 108848247 missense probably benign 0.00
BB003:Kti12 UTSW 4 108848246 missense probably benign
BB003:Kti12 UTSW 4 108848247 missense probably benign 0.00
BB004:Kti12 UTSW 4 108848246 missense probably benign
BB004:Kti12 UTSW 4 108848247 missense probably benign 0.00
BB006:Kti12 UTSW 4 108848246 missense probably benign
BB006:Kti12 UTSW 4 108848247 missense probably benign 0.00
BB012:Kti12 UTSW 4 108848246 missense probably benign
BB013:Kti12 UTSW 4 108848246 missense probably benign
BB013:Kti12 UTSW 4 108848247 missense probably benign 0.00
BB014:Kti12 UTSW 4 108848246 missense probably benign
BB014:Kti12 UTSW 4 108848247 missense probably benign 0.00
BB016:Kti12 UTSW 4 108848246 missense probably benign
BB016:Kti12 UTSW 4 108848247 missense probably benign 0.00
R0518:Kti12 UTSW 4 108848579 missense possibly damaging 0.95
R1681:Kti12 UTSW 4 108848858 missense probably damaging 1.00
R5510:Kti12 UTSW 4 108848624 missense probably damaging 1.00
R5522:Kti12 UTSW 4 108848423 missense possibly damaging 0.58
R6652:Kti12 UTSW 4 108848533 missense probably benign 0.00
R6774:Kti12 UTSW 4 108848455 missense probably benign 0.12
R7123:Kti12 UTSW 4 108848482 missense probably benign 0.00
R7856:Kti12 UTSW 4 108848246 missense probably benign
R7856:Kti12 UTSW 4 108848247 missense probably benign 0.00
R7858:Kti12 UTSW 4 108848246 missense probably benign
R7858:Kti12 UTSW 4 108848247 missense probably benign 0.00
R7859:Kti12 UTSW 4 108848246 missense probably benign
R7859:Kti12 UTSW 4 108848247 missense probably benign 0.00
R7914:Kti12 UTSW 4 108848246 missense probably benign
R7914:Kti12 UTSW 4 108848247 missense probably benign 0.00
R7915:Kti12 UTSW 4 108848246 missense probably benign
R7915:Kti12 UTSW 4 108848247 missense probably benign 0.00
R7916:Kti12 UTSW 4 108848246 missense probably benign
R7916:Kti12 UTSW 4 108848247 missense probably benign 0.00
R7917:Kti12 UTSW 4 108848246 missense probably benign
R7917:Kti12 UTSW 4 108848247 missense probably benign 0.00
R7918:Kti12 UTSW 4 108848246 missense probably benign
R7918:Kti12 UTSW 4 108848247 missense probably benign 0.00
R7925:Kti12 UTSW 4 108848246 missense probably benign
R7925:Kti12 UTSW 4 108848247 missense probably benign 0.00
R7926:Kti12 UTSW 4 108848246 missense probably benign
R7926:Kti12 UTSW 4 108848247 missense probably benign 0.00
R7927:Kti12 UTSW 4 108848246 missense probably benign
R7927:Kti12 UTSW 4 108848247 missense probably benign 0.00
R7929:Kti12 UTSW 4 108848246 missense probably benign
R7929:Kti12 UTSW 4 108848247 missense probably benign 0.00
R8099:Kti12 UTSW 4 108848374 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAGTTGACGCCAAACATCCG -3'
(R):5'- GGATTTCCTCTGGATCCAGTTC -3'

Sequencing Primer
(F):5'- ATGGATGCCCCTGGAGATCATG -3'
(R):5'- GGATCCAGTTCCTTTGAGACAGC -3'
Posted On2020-08-01