Incidental Mutation 'BB012:Sh2b2'
ID642701
Institutional Source Beutler Lab
Gene Symbol Sh2b2
Ensembl Gene ENSMUSG00000005057
Gene NameSH2B adaptor protein 2
SynonymsAps
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.937) question?
Stock #BB012
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location136218147-136246556 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 136224261 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 352 (H352Q)
Ref Sequence ENSEMBL: ENSMUSP00000005188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005188] [ENSMUST00000196397] [ENSMUST00000196447]
PDB Structure Solution Structure of the Pleckstrin Homology Domain of Mouse APS [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000005188
AA Change: H352Q

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000005188
Gene: ENSMUSG00000005057
AA Change: H352Q

DomainStartEndE-ValueType
low complexity region 6 16 N/A INTRINSIC
Pfam:Phe_ZIP 17 73 9.3e-22 PFAM
Blast:PH 95 168 2e-21 BLAST
low complexity region 169 180 N/A INTRINSIC
PH 187 301 4.97e-9 SMART
low complexity region 340 350 N/A INTRINSIC
low complexity region 388 404 N/A INTRINSIC
SH2 407 492 1.38e-21 SMART
low complexity region 509 525 N/A INTRINSIC
low complexity region 548 576 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196397
AA Change: H352Q

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000142398
Gene: ENSMUSG00000005057
AA Change: H352Q

DomainStartEndE-ValueType
Pfam:Phe_ZIP 16 74 1.5e-30 PFAM
Blast:PH 95 168 2e-21 BLAST
low complexity region 169 180 N/A INTRINSIC
PH 187 301 4.97e-9 SMART
low complexity region 340 350 N/A INTRINSIC
low complexity region 388 404 N/A INTRINSIC
SH2 407 492 1.38e-21 SMART
low complexity region 509 525 N/A INTRINSIC
low complexity region 548 576 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000196447
AA Change: H352Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142728
Gene: ENSMUSG00000005057
AA Change: H352Q

DomainStartEndE-ValueType
Pfam:Phe_ZIP 16 74 9.1e-28 PFAM
Blast:PH 95 168 9e-22 BLAST
low complexity region 169 180 N/A INTRINSIC
PH 187 301 2.2e-11 SMART
low complexity region 340 350 N/A INTRINSIC
low complexity region 406 417 N/A INTRINSIC
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is expressed in B lymphocytes and contains pleckstrin homology and src homology 2 (SH2) domains. In Burkitt's lymphoma cell lines, it is tyrosine-phosphorylated in response to B cell receptor stimulation. Because it binds Shc independent of stimulation and Grb2 after stimulation, it appears to play a role in signal transduction from the receptor to the Shc/Grb2 pathway. [provided by RefSeq, Jun 2009]
PHENOTYPE: Inactivation of this gene results in increased insulin sensitivity accompanied by hypoinsulinemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik C T 7: 40,994,082 Q392* probably null Het
4933427D14Rik A C 11: 72,180,501 L473V probably benign Het
A930002H24Rik A T 17: 63,863,397 V132E unknown Het
Abcc2 A G 19: 43,807,112 I436V probably benign Het
Ahr G A 12: 35,515,068 Q103* probably null Het
Asb15 T A 6: 24,562,724 H228Q probably benign Het
Asphd1 T A 7: 126,948,456 Y225F probably damaging Het
Atp2c1 A G 9: 105,442,770 M468T possibly damaging Het
BC030499 T C 11: 78,291,623 L86P probably damaging Het
Brca1 A G 11: 101,508,146 I1540T probably benign Het
Cdh20 A T 1: 104,984,748 I576F probably damaging Het
Chst11 T A 10: 83,190,954 S72T probably damaging Het
Cldn17 T G 16: 88,506,645 K65N probably damaging Het
Cldn22 T C 8: 47,825,187 I220T probably benign Het
Coasy T G 11: 101,083,696 D229E probably benign Het
Colec10 T C 15: 54,462,371 V199A probably damaging Het
Cpn2 G T 16: 30,260,801 D27E probably damaging Het
F5 T A 1: 164,176,366 probably null Het
Fat3 C T 9: 16,031,360 V1239I possibly damaging Het
Fbxl16 A G 17: 25,816,906 N159S probably benign Het
Fhad1 A G 4: 141,954,187 I514T probably damaging Het
Fras1 A G 5: 96,781,584 K3949R probably damaging Het
Gm10800 AAAGAAAACTGAA ACAAGAAAACTGAA 2: 98,667,033 probably null Het
Grm3 T A 5: 9,589,880 E55V probably benign Het
Itgbl1 G A 14: 123,973,323 D478N possibly damaging Het
Kcnt2 T A 1: 140,354,509 Y77* probably null Het
Kdm4c T C 4: 74,404,821 S997P probably damaging Het
Kti12 A C 4: 108,848,246 E119A probably benign Het
Kti12 G T 4: 108,848,247 E119D probably benign Het
Lrrc28 T C 7: 67,619,109 Y71C probably damaging Het
Lrrc45 T A 11: 120,715,880 W203R probably benign Het
Lrrc66 A T 5: 73,608,492 C403S possibly damaging Het
Ly6g6e A T 17: 35,077,918 E45V probably damaging Het
Mgam C T 6: 40,759,051 T1574I probably damaging Het
Msrb2 A T 2: 19,383,280 M80L probably benign Het
Musk T A 4: 58,367,513 L592Q probably damaging Het
Nlrp4a C A 7: 26,450,586 N539K probably benign Het
Obscn C G 11: 59,112,555 E1306Q probably benign Het
Olfr1006 T C 2: 85,674,563 E196G Het
Olfr1291-ps1 A G 2: 111,499,821 S190G probably damaging Het
Olfr355 A G 2: 36,927,359 F252L possibly damaging Het
Olfr388-ps1 A G 11: 73,724,536 S163P unknown Het
Opalin T A 19: 41,063,803 *144C probably null Het
Pgam2 T A 11: 5,803,007 H196L possibly damaging Het
Pgls T C 8: 71,592,352 S46P probably damaging Het
Prrc2b A G 2: 32,204,115 E503G probably damaging Het
Prss45 T C 9: 110,841,035 L304P unknown Het
Rbm20 T A 19: 53,813,322 V87D probably damaging Het
Serpinb8 T C 1: 107,598,985 L85S probably benign Het
Slc6a17 T C 3: 107,495,740 I124V probably damaging Het
Smim10l1 G A 6: 133,105,582 V31M probably damaging Het
Snx10 T C 6: 51,580,321 S78P probably benign Het
Stard10 T C 7: 101,342,631 V187A probably damaging Het
Svil C A 18: 5,118,357 D2146E probably benign Het
Tsc22d4 A G 5: 137,751,365 D301G probably null Het
Ube3c T A 5: 29,646,431 I752N probably damaging Het
Wisp2 G C 2: 163,829,041 R156T possibly damaging Het
Wwc1 T C 11: 35,844,163 M962V probably benign Het
Other mutations in Sh2b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Sh2b2 APN 5 136224419 missense probably damaging 1.00
IGL01456:Sh2b2 APN 5 136224467 missense probably damaging 0.98
IGL01612:Sh2b2 APN 5 136231802 missense probably benign 0.02
IGL02798:Sh2b2 APN 5 136221963 missense probably damaging 1.00
BB002:Sh2b2 UTSW 5 136224261 missense probably benign 0.04
R0492:Sh2b2 UTSW 5 136232263 missense probably damaging 1.00
R0539:Sh2b2 UTSW 5 136225301 splice site probably benign
R0707:Sh2b2 UTSW 5 136232263 missense probably damaging 1.00
R1569:Sh2b2 UTSW 5 136231735 missense possibly damaging 0.89
R1777:Sh2b2 UTSW 5 136227422 missense probably damaging 1.00
R2088:Sh2b2 UTSW 5 136232114 missense possibly damaging 0.87
R3702:Sh2b2 UTSW 5 136224233 missense probably damaging 0.99
R4223:Sh2b2 UTSW 5 136219053 missense possibly damaging 0.91
R4597:Sh2b2 UTSW 5 136231762 missense probably damaging 0.99
R4683:Sh2b2 UTSW 5 136231720 missense probably damaging 1.00
R4766:Sh2b2 UTSW 5 136231957 missense probably damaging 0.99
R5486:Sh2b2 UTSW 5 136232090 missense probably benign 0.10
R6060:Sh2b2 UTSW 5 136232355 missense possibly damaging 0.72
R6322:Sh2b2 UTSW 5 136224188 missense probably damaging 0.99
R7020:Sh2b2 UTSW 5 136224299 missense possibly damaging 0.69
R7034:Sh2b2 UTSW 5 136218885 missense probably benign 0.18
R7036:Sh2b2 UTSW 5 136218885 missense probably benign 0.18
R7615:Sh2b2 UTSW 5 136219657 missense probably damaging 1.00
R7715:Sh2b2 UTSW 5 136219035 missense probably benign 0.09
R7925:Sh2b2 UTSW 5 136224261 missense probably benign 0.04
R8244:Sh2b2 UTSW 5 136227437 nonsense probably null
R8291:Sh2b2 UTSW 5 136232355 missense possibly damaging 0.72
R8786:Sh2b2 UTSW 5 136231804 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- ACTGGCTGAAATGTCACCAC -3'
(R):5'- CACAGGACTGTCTTGTGCAC -3'

Sequencing Primer
(F):5'- GCTGAAATGTCACCACTTCTGAGG -3'
(R):5'- ACTGTCTTGTGCACGGGGAG -3'
Posted On2020-08-01