Incidental Mutation 'R0051:Rtel1'
ID 64272
Institutional Source Beutler Lab
Gene Symbol Rtel1
Ensembl Gene ENSMUSG00000038685
Gene Name regulator of telomere elongation helicase 1
Synonyms Nhl, Rtel, KIAA1088, C20ORF41
MMRRC Submission 038345-MU
Accession Numbers

Ncbi RefSeq: NM_001001882.3, NM_001166665.1, NM_001166666.1, NM_001166667.1, NM_001166668.1; MGI: 2139369

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R0051 (G1)
Quality Score 196
Status Validated
Chromosome 2
Chromosomal Location 181319739-181356616 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 181350656 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 424 (Q424*)
Ref Sequence ENSEMBL: ENSMUSP00000116159 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048608] [ENSMUST00000054622] [ENSMUST00000098971] [ENSMUST00000108814] [ENSMUST00000108815] [ENSMUST00000148252]
AlphaFold Q0VGM9
Predicted Effect probably null
Transcript: ENSMUST00000048608
AA Change: Q608*
SMART Domains Protein: ENSMUSP00000043563
Gene: ENSMUSG00000038685
AA Change: Q608*

DomainStartEndE-ValueType
DEXDc 13 292 9.88e-3 SMART
HELICc 563 717 1.07e-62 SMART
Predicted Effect probably null
Transcript: ENSMUST00000054622
AA Change: Q608*
SMART Domains Protein: ENSMUSP00000053120
Gene: ENSMUSG00000038685
AA Change: Q608*

DomainStartEndE-ValueType
DEXDc 13 292 9.88e-3 SMART
HELICc 563 717 1.07e-62 SMART
low complexity region 1075 1092 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000098971
AA Change: Q608*
SMART Domains Protein: ENSMUSP00000096571
Gene: ENSMUSG00000038685
AA Change: Q608*

DomainStartEndE-ValueType
DEXDc 13 292 9.88e-3 SMART
HELICc 563 717 1.07e-62 SMART
low complexity region 1036 1053 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108814
AA Change: Q608*
SMART Domains Protein: ENSMUSP00000104442
Gene: ENSMUSG00000038685
AA Change: Q608*

DomainStartEndE-ValueType
DEXDc 13 292 9.88e-3 SMART
HELICc 563 717 1.07e-62 SMART
low complexity region 1069 1086 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108815
AA Change: Q608*
SMART Domains Protein: ENSMUSP00000104443
Gene: ENSMUSG00000038685
AA Change: Q608*

DomainStartEndE-ValueType
DEXDc 13 292 9.88e-3 SMART
HELICc 563 717 1.07e-62 SMART
low complexity region 1030 1047 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125233
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126842
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130772
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130935
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139601
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139608
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144648
Predicted Effect probably null
Transcript: ENSMUST00000148252
AA Change: Q424*
SMART Domains Protein: ENSMUSP00000116159
Gene: ENSMUSG00000038685
AA Change: Q424*

DomainStartEndE-ValueType
Pfam:DEAD_2 1 88 1.3e-33 PFAM
HELICc 379 533 1.07e-62 SMART
low complexity region 858 875 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147266
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146273
Predicted Effect probably benign
Transcript: ENSMUST00000184751
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 93.8%
Validation Efficiency 100% (64/64)
MGI Phenotype Strain: 3772371; 3052235
Lethality: E11-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA helicase which functions in the stability, protection and elongation of telomeres and interacts with proteins in the shelterin complex known to protect telomeres during DNA replication. Mutations in this gene have been associated with dyskeratosis congenita and Hoyerall-Hreidarsson syndrome. Read-through transcription of this gene into the neighboring downstream gene, which encodes tumor necrosis factor receptor superfamily, member 6b, generates a non-coding transcript. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2013]
PHENOTYPE: Homozygous null mice display embryonic lethality with abnormal development of the neural tube, brain, heart, vasculature, placenta, and allantois and chromosomal abnormalities in differentiating cells. [provided by MGI curators]
Allele List at MGI

All alleles(33) : Targeted(5) Gene trapped(28)

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik A G 7: 29,579,101 noncoding transcript Het
Abr T A 11: 76,472,502 Q163L probably benign Het
AI314180 A G 4: 58,832,729 L877S probably damaging Het
Ankrd11 C A 8: 122,889,742 C2457F probably damaging Het
Anks3 G C 16: 4,947,749 T163S probably benign Het
Cacna1d G A 14: 30,111,095 P908S probably damaging Het
Ccdc146 C A 5: 21,316,904 R374L possibly damaging Het
Cdc45 G T 16: 18,794,774 A348E probably damaging Het
Cfap46 A G 7: 139,676,035 C300R probably damaging Het
Coq2 T C 5: 100,663,685 N146S probably benign Het
Dalrd3 T C 9: 108,572,215 V120A possibly damaging Het
Dcp2 T A 18: 44,405,374 probably benign Het
Ddx39 A G 8: 83,720,622 K137R possibly damaging Het
Diaph3 A G 14: 87,037,454 probably null Het
Dmbt1 G T 7: 131,119,496 R1668L possibly damaging Het
Dnah7a T G 1: 53,521,086 probably benign Het
Dpp7 A G 2: 25,356,095 Y49H possibly damaging Het
Drd5 A G 5: 38,320,614 S317G probably benign Het
Ecsit C T 9: 22,076,288 V152I probably benign Het
Emc1 T A 4: 139,375,163 M923K possibly damaging Het
Fam102a G A 2: 32,558,053 R58Q possibly damaging Het
Fcrl6 A T 1: 172,598,753 L159Q probably benign Het
Frrs1 T C 3: 116,885,297 probably benign Het
Hspd1 A G 1: 55,082,046 probably benign Het
Impg2 T A 16: 56,258,048 S458T probably damaging Het
Klf17 T C 4: 117,760,392 Y256C probably damaging Het
Lnx2 A G 5: 147,029,353 F319L probably damaging Het
Mafg G T 11: 120,629,604 R57S probably damaging Het
Med13l T A 5: 118,742,655 W1271R probably damaging Het
Mrgprb1 A G 7: 48,447,214 S24P probably benign Het
Mtrf1l T C 10: 5,813,384 E315G probably damaging Het
Naip1 T C 13: 100,411,001 E1239G probably damaging Het
Ncaph2 T C 15: 89,369,664 S320P probably damaging Het
Nek11 A G 9: 105,218,539 probably benign Het
Nlrp2 A T 7: 5,322,334 probably benign Het
Odf3 C A 7: 140,850,221 probably benign Het
Rbm26 A C 14: 105,152,540 V216G possibly damaging Het
Rnf115 A G 3: 96,785,022 D178G probably damaging Het
Rwdd4a A G 8: 47,537,365 probably benign Het
Ryr3 T C 2: 112,869,075 D890G probably damaging Het
Scarb1 C A 5: 125,281,100 probably null Het
Serpina10 A G 12: 103,626,897 probably benign Het
Slc12a5 T A 2: 164,986,663 W508R probably damaging Het
Slc43a2 T C 11: 75,562,850 C225R probably damaging Het
Slc6a9 T C 4: 117,864,859 F440L probably damaging Het
Stac3 G A 10: 127,508,148 R305H probably damaging Het
Stk32b A G 5: 37,459,596 probably benign Het
Syna A T 5: 134,559,543 L184H probably damaging Het
Tmprss7 T C 16: 45,673,939 N401S probably damaging Het
Yeats2 T A 16: 20,193,724 Y557* probably null Het
Zcchc11 T G 4: 108,527,004 S1089R probably damaging Het
Zfp352 T C 4: 90,224,285 S221P probably damaging Het
Zfp575 A G 7: 24,586,087 V43A probably benign Het
Zfp775 A G 6: 48,620,772 T527A probably benign Het
Other mutations in Rtel1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01420:Rtel1 APN 2 181354401 missense probably benign 0.16
IGL01957:Rtel1 APN 2 181349313 unclassified probably benign
IGL02247:Rtel1 APN 2 181351341 nonsense probably null
IGL02414:Rtel1 APN 2 181335972 missense probably benign 0.01
IGL02448:Rtel1 APN 2 181336037 missense probably benign 0.00
IGL03053:Rtel1 APN 2 181351944 missense probably benign 0.02
IGL03059:Rtel1 APN 2 181350183 missense probably benign 0.01
IGL03326:Rtel1 APN 2 181355561 unclassified probably benign
PIT4283001:Rtel1 UTSW 2 181346890 missense probably benign 0.00
R0047:Rtel1 UTSW 2 181323405 missense probably damaging 1.00
R0047:Rtel1 UTSW 2 181323405 missense probably damaging 1.00
R0051:Rtel1 UTSW 2 181350656 nonsense probably null
R0147:Rtel1 UTSW 2 181321046 missense probably damaging 1.00
R0148:Rtel1 UTSW 2 181321046 missense probably damaging 1.00
R0316:Rtel1 UTSW 2 181356002 missense possibly damaging 0.87
R0628:Rtel1 UTSW 2 181351881 missense probably benign 0.03
R0940:Rtel1 UTSW 2 181322803 missense probably benign 0.36
R1165:Rtel1 UTSW 2 181334939 missense probably benign 0.26
R1213:Rtel1 UTSW 2 181351335 missense probably benign 0.01
R1291:Rtel1 UTSW 2 181351043 missense probably damaging 1.00
R1353:Rtel1 UTSW 2 181349231 missense probably benign
R1398:Rtel1 UTSW 2 181335865 splice site probably null
R1796:Rtel1 UTSW 2 181352103 missense probably benign 0.01
R1973:Rtel1 UTSW 2 181351626 missense probably benign 0.04
R2033:Rtel1 UTSW 2 181351863 nonsense probably null
R2144:Rtel1 UTSW 2 181323706 missense probably damaging 0.97
R2265:Rtel1 UTSW 2 181354368 missense probably damaging 1.00
R2269:Rtel1 UTSW 2 181336003 missense probably benign 0.00
R2416:Rtel1 UTSW 2 181340531 missense possibly damaging 0.66
R2865:Rtel1 UTSW 2 181349972 missense probably benign 0.36
R3508:Rtel1 UTSW 2 181322409 missense probably benign 0.32
R4242:Rtel1 UTSW 2 181349934 missense probably damaging 1.00
R4377:Rtel1 UTSW 2 181355796 missense probably damaging 1.00
R4702:Rtel1 UTSW 2 181352169 missense probably benign 0.30
R4706:Rtel1 UTSW 2 181323746 critical splice donor site probably null
R4817:Rtel1 UTSW 2 181355935 missense possibly damaging 0.82
R5020:Rtel1 UTSW 2 181322514 splice site probably null
R5069:Rtel1 UTSW 2 181355492 missense probably benign 0.03
R5222:Rtel1 UTSW 2 181346983 intron probably benign
R5268:Rtel1 UTSW 2 181340561 missense probably benign 0.03
R5291:Rtel1 UTSW 2 181352095 missense possibly damaging 0.47
R5588:Rtel1 UTSW 2 181352100 missense probably benign
R5682:Rtel1 UTSW 2 181349972 missense probably benign 0.19
R5796:Rtel1 UTSW 2 181340506 missense probably benign 0.26
R5931:Rtel1 UTSW 2 181330815 nonsense probably null
R6249:Rtel1 UTSW 2 181351682 missense probably damaging 1.00
R6465:Rtel1 UTSW 2 181335940 missense possibly damaging 0.68
R6616:Rtel1 UTSW 2 181352786 missense possibly damaging 0.68
R6800:Rtel1 UTSW 2 181322463 missense probably benign 0.31
R6835:Rtel1 UTSW 2 181355953 missense probably benign 0.04
R6917:Rtel1 UTSW 2 181338277 makesense probably null
R7264:Rtel1 UTSW 2 181351861 missense not run
R7381:Rtel1 UTSW 2 181330815 nonsense probably null
R7523:Rtel1 UTSW 2 181322315 missense probably damaging 1.00
R7587:Rtel1 UTSW 2 181322315 missense probably damaging 1.00
R7681:Rtel1 UTSW 2 181322394 missense probably damaging 0.99
R7871:Rtel1 UTSW 2 181321029 missense probably damaging 1.00
R7912:Rtel1 UTSW 2 181356076 missense possibly damaging 0.56
R8007:Rtel1 UTSW 2 181334974 missense probably damaging 1.00
R8062:Rtel1 UTSW 2 181340567 missense probably benign 0.17
R8088:Rtel1 UTSW 2 181322345 missense probably damaging 1.00
R8435:Rtel1 UTSW 2 181354104 missense possibly damaging 0.93
R8873:Rtel1 UTSW 2 181356023 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AACCCAGCAGCTACCCTGTCTATG -3'
(R):5'- TCCTTGGCTATTAGCACCCAGCAC -3'

Sequencing Primer
(F):5'- AATACTAGACAGGCTCTGGGTATTG -3'
(R):5'- GCACAGCCCCTAGTATAGCTC -3'
Posted On 2013-08-06