Mutagenetix > Incidental Mutation

Incidental Mutation 'R0051:Rtel1'

64272

Institutional Source

Beutler Lab

Gene Symbol

Rtel1

Ensembl Gene

ENSMUSG00000038685

Gene Name

regulator of telomere elongation helicase 1

Synonyms

Nhl, Rtel, KIAA1088, C20ORF41

MMRRC Submission

038345-MU

Accession Numbers

Ncbi RefSeq: NM_001001882.3, NM_001166665.1, NM_001166666.1, NM_001166667.1, NM_001166668.1; MGI: 2139369

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0051 (G1)

Quality Score

196

Status

Validated

Chromosome

Chromosomal Location

181319739-181356616 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to T at 181350656 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Stop codon at position 424 (Q424*)

Ref Sequence

ENSEMBL: ENSMUSP00000116159 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048608] [ENSMUST00000054622] [ENSMUST00000098971] [ENSMUST00000108814] [ENSMUST00000108815] [ENSMUST00000148252]

AlphaFold

Q0VGM9

Predicted Effect

probably null
Transcript: ENSMUST00000048608
AA Change: Q608*

SMART Domains

Protein: ENSMUSP00000043563
Gene: ENSMUSG00000038685
AA Change: Q608*

Domain	Start	End	E-Value	Type
DEXDc	13	292	9.88e-3	SMART
HELICc	563	717	1.07e-62	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000054622
AA Change: Q608*

SMART Domains

Protein: ENSMUSP00000053120
Gene: ENSMUSG00000038685
AA Change: Q608*

Domain	Start	End	E-Value	Type
DEXDc	13	292	9.88e-3	SMART
HELICc	563	717	1.07e-62	SMART
low complexity region	1075	1092	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000098971
AA Change: Q608*

SMART Domains

Protein: ENSMUSP00000096571
Gene: ENSMUSG00000038685
AA Change: Q608*

Domain	Start	End	E-Value	Type
DEXDc	13	292	9.88e-3	SMART
HELICc	563	717	1.07e-62	SMART
low complexity region	1036	1053	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000108814
AA Change: Q608*

SMART Domains

Protein: ENSMUSP00000104442
Gene: ENSMUSG00000038685
AA Change: Q608*

Domain	Start	End	E-Value	Type
DEXDc	13	292	9.88e-3	SMART
HELICc	563	717	1.07e-62	SMART
low complexity region	1069	1086	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000108815
AA Change: Q608*

SMART Domains

Protein: ENSMUSP00000104443
Gene: ENSMUSG00000038685
AA Change: Q608*

Domain	Start	End	E-Value	Type
DEXDc	13	292	9.88e-3	SMART
HELICc	563	717	1.07e-62	SMART
low complexity region	1030	1047	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125233

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126842

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130772

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130935

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139601

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139608

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144648

Predicted Effect

probably null
Transcript: ENSMUST00000148252
AA Change: Q424*

SMART Domains

Protein: ENSMUSP00000116159
Gene: ENSMUSG00000038685
AA Change: Q424*

Domain	Start	End	E-Value	Type
Pfam:DEAD_2	1	88	1.3e-33	PFAM
HELICc	379	533	1.07e-62	SMART
low complexity region	858	875	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147266

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146273

Predicted Effect

probably benign
Transcript: ENSMUST00000184751

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.1%
20x: 93.8%

Validation Efficiency

100% (64/64)

MGI Phenotype

Strain: 3772371; 3052235
Lethality: E11-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA helicase which functions in the stability, protection and elongation of telomeres and interacts with proteins in the shelterin complex known to protect telomeres during DNA replication. Mutations in this gene have been associated with dyskeratosis congenita and Hoyerall-Hreidarsson syndrome. Read-through transcription of this gene into the neighboring downstream gene, which encodes tumor necrosis factor receptor superfamily, member 6b, generates a non-coding transcript. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2013]
PHENOTYPE: Homozygous null mice display embryonic lethality with abnormal development of the neural tube, brain, heart, vasculature, placenta, and allantois and chromosomal abnormalities in differentiating cells. [provided by MGI curators]

Allele List at MGI

All alleles(33) : Targeted(5) Gene trapped(28)

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930432E11Rik	A	G	7: 29,579,101		noncoding transcript	Het
Abr	T	A	11: 76,472,502	Q163L	probably benign	Het
AI314180	A	G	4: 58,832,729	L877S	probably damaging	Het
Ankrd11	C	A	8: 122,889,742	C2457F	probably damaging	Het
Anks3	G	C	16: 4,947,749	T163S	probably benign	Het
Cacna1d	G	A	14: 30,111,095	P908S	probably damaging	Het
Ccdc146	C	A	5: 21,316,904	R374L	possibly damaging	Het
Cdc45	G	T	16: 18,794,774	A348E	probably damaging	Het
Cfap46	A	G	7: 139,676,035	C300R	probably damaging	Het
Coq2	T	C	5: 100,663,685	N146S	probably benign	Het
Dalrd3	T	C	9: 108,572,215	V120A	possibly damaging	Het
Dcp2	T	A	18: 44,405,374		probably benign	Het
Ddx39	A	G	8: 83,720,622	K137R	possibly damaging	Het
Diaph3	A	G	14: 87,037,454		probably null	Het
Dmbt1	G	T	7: 131,119,496	R1668L	possibly damaging	Het
Dnah7a	T	G	1: 53,521,086		probably benign	Het
Dpp7	A	G	2: 25,356,095	Y49H	possibly damaging	Het
Drd5	A	G	5: 38,320,614	S317G	probably benign	Het
Ecsit	C	T	9: 22,076,288	V152I	probably benign	Het
Emc1	T	A	4: 139,375,163	M923K	possibly damaging	Het
Fam102a	G	A	2: 32,558,053	R58Q	possibly damaging	Het
Fcrl6	A	T	1: 172,598,753	L159Q	probably benign	Het
Frrs1	T	C	3: 116,885,297		probably benign	Het
Hspd1	A	G	1: 55,082,046		probably benign	Het
Impg2	T	A	16: 56,258,048	S458T	probably damaging	Het
Klf17	T	C	4: 117,760,392	Y256C	probably damaging	Het
Lnx2	A	G	5: 147,029,353	F319L	probably damaging	Het
Mafg	G	T	11: 120,629,604	R57S	probably damaging	Het
Med13l	T	A	5: 118,742,655	W1271R	probably damaging	Het
Mrgprb1	A	G	7: 48,447,214	S24P	probably benign	Het
Mtrf1l	T	C	10: 5,813,384	E315G	probably damaging	Het
Naip1	T	C	13: 100,411,001	E1239G	probably damaging	Het
Ncaph2	T	C	15: 89,369,664	S320P	probably damaging	Het
Nek11	A	G	9: 105,218,539		probably benign	Het
Nlrp2	A	T	7: 5,322,334		probably benign	Het
Odf3	C	A	7: 140,850,221		probably benign	Het
Rbm26	A	C	14: 105,152,540	V216G	possibly damaging	Het
Rnf115	A	G	3: 96,785,022	D178G	probably damaging	Het
Rwdd4a	A	G	8: 47,537,365		probably benign	Het
Ryr3	T	C	2: 112,869,075	D890G	probably damaging	Het
Scarb1	C	A	5: 125,281,100		probably null	Het
Serpina10	A	G	12: 103,626,897		probably benign	Het
Slc12a5	T	A	2: 164,986,663	W508R	probably damaging	Het
Slc43a2	T	C	11: 75,562,850	C225R	probably damaging	Het
Slc6a9	T	C	4: 117,864,859	F440L	probably damaging	Het
Stac3	G	A	10: 127,508,148	R305H	probably damaging	Het
Stk32b	A	G	5: 37,459,596		probably benign	Het
Syna	A	T	5: 134,559,543	L184H	probably damaging	Het
Tmprss7	T	C	16: 45,673,939	N401S	probably damaging	Het
Yeats2	T	A	16: 20,193,724	Y557*	probably null	Het
Zcchc11	T	G	4: 108,527,004	S1089R	probably damaging	Het
Zfp352	T	C	4: 90,224,285	S221P	probably damaging	Het
Zfp575	A	G	7: 24,586,087	V43A	probably benign	Het
Zfp775	A	G	6: 48,620,772	T527A	probably benign	Het

Other mutations in Rtel1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01420:Rtel1	APN	2	181354401	missense	probably benign	0.16
IGL01957:Rtel1	APN	2	181349313	unclassified	probably benign
IGL02247:Rtel1	APN	2	181351341	nonsense	probably null
IGL02414:Rtel1	APN	2	181335972	missense	probably benign	0.01
IGL02448:Rtel1	APN	2	181336037	missense	probably benign	0.00
IGL03053:Rtel1	APN	2	181351944	missense	probably benign	0.02
IGL03059:Rtel1	APN	2	181350183	missense	probably benign	0.01
IGL03326:Rtel1	APN	2	181355561	unclassified	probably benign
PIT4283001:Rtel1	UTSW	2	181346890	missense	probably benign	0.00
R0047:Rtel1	UTSW	2	181323405	missense	probably damaging	1.00
R0047:Rtel1	UTSW	2	181323405	missense	probably damaging	1.00
R0051:Rtel1	UTSW	2	181350656	nonsense	probably null
R0147:Rtel1	UTSW	2	181321046	missense	probably damaging	1.00
R0148:Rtel1	UTSW	2	181321046	missense	probably damaging	1.00
R0316:Rtel1	UTSW	2	181356002	missense	possibly damaging	0.87
R0628:Rtel1	UTSW	2	181351881	missense	probably benign	0.03
R0940:Rtel1	UTSW	2	181322803	missense	probably benign	0.36
R1165:Rtel1	UTSW	2	181334939	missense	probably benign	0.26
R1213:Rtel1	UTSW	2	181351335	missense	probably benign	0.01
R1291:Rtel1	UTSW	2	181351043	missense	probably damaging	1.00
R1353:Rtel1	UTSW	2	181349231	missense	probably benign
R1398:Rtel1	UTSW	2	181335865	splice site	probably null
R1796:Rtel1	UTSW	2	181352103	missense	probably benign	0.01
R1973:Rtel1	UTSW	2	181351626	missense	probably benign	0.04
R2033:Rtel1	UTSW	2	181351863	nonsense	probably null
R2144:Rtel1	UTSW	2	181323706	missense	probably damaging	0.97
R2265:Rtel1	UTSW	2	181354368	missense	probably damaging	1.00
R2269:Rtel1	UTSW	2	181336003	missense	probably benign	0.00
R2416:Rtel1	UTSW	2	181340531	missense	possibly damaging	0.66
R2865:Rtel1	UTSW	2	181349972	missense	probably benign	0.36
R3508:Rtel1	UTSW	2	181322409	missense	probably benign	0.32
R4242:Rtel1	UTSW	2	181349934	missense	probably damaging	1.00
R4377:Rtel1	UTSW	2	181355796	missense	probably damaging	1.00
R4702:Rtel1	UTSW	2	181352169	missense	probably benign	0.30
R4706:Rtel1	UTSW	2	181323746	critical splice donor site	probably null
R4817:Rtel1	UTSW	2	181355935	missense	possibly damaging	0.82
R5020:Rtel1	UTSW	2	181322514	splice site	probably null
R5069:Rtel1	UTSW	2	181355492	missense	probably benign	0.03
R5222:Rtel1	UTSW	2	181346983	intron	probably benign
R5268:Rtel1	UTSW	2	181340561	missense	probably benign	0.03
R5291:Rtel1	UTSW	2	181352095	missense	possibly damaging	0.47
R5588:Rtel1	UTSW	2	181352100	missense	probably benign
R5682:Rtel1	UTSW	2	181349972	missense	probably benign	0.19
R5796:Rtel1	UTSW	2	181340506	missense	probably benign	0.26
R5931:Rtel1	UTSW	2	181330815	nonsense	probably null
R6249:Rtel1	UTSW	2	181351682	missense	probably damaging	1.00
R6465:Rtel1	UTSW	2	181335940	missense	possibly damaging	0.68
R6616:Rtel1	UTSW	2	181352786	missense	possibly damaging	0.68
R6800:Rtel1	UTSW	2	181322463	missense	probably benign	0.31
R6835:Rtel1	UTSW	2	181355953	missense	probably benign	0.04
R6917:Rtel1	UTSW	2	181338277	makesense	probably null
R7264:Rtel1	UTSW	2	181351861	missense	not run
R7381:Rtel1	UTSW	2	181330815	nonsense	probably null
R7523:Rtel1	UTSW	2	181322315	missense	probably damaging	1.00
R7587:Rtel1	UTSW	2	181322315	missense	probably damaging	1.00
R7681:Rtel1	UTSW	2	181322394	missense	probably damaging	0.99
R7871:Rtel1	UTSW	2	181321029	missense	probably damaging	1.00
R7912:Rtel1	UTSW	2	181356076	missense	possibly damaging	0.56
R8007:Rtel1	UTSW	2	181334974	missense	probably damaging	1.00
R8062:Rtel1	UTSW	2	181340567	missense	probably benign	0.17
R8088:Rtel1	UTSW	2	181322345	missense	probably damaging	1.00
R8435:Rtel1	UTSW	2	181354104	missense	possibly damaging	0.93
R8873:Rtel1	UTSW	2	181356023	frame shift	probably null
R9441:Rtel1	UTSW	2	181347067	missense	possibly damaging	0.89
R9704:Rtel1	UTSW	2	181352112	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- AACCCAGCAGCTACCCTGTCTATG -3'
(R):5'- TCCTTGGCTATTAGCACCCAGCAC -3'

Sequencing Primer
(F):5'- AATACTAGACAGGCTCTGGGTATTG -3'
(R):5'- GCACAGCCCCTAGTATAGCTC -3'

Posted On

2013-08-06