Mutagenetix > Incidental Mutations

Ensembl: ENSMUST00000019400

Incidental Mutation 'BB012:Ahr'

642734

Institutional Source

Beutler Lab

Gene Symbol

Ahr

Ensembl Gene

ENSMUSG00000019256

Gene Name

aryl-hydrocarbon receptor

Synonyms

bHLHe76, In, dioxin receptor, Ah, Ahh, Ahre

Accession Numbers

Genbank: NM_013464; MGI: 105043;

Is this an essential gene?

Probably essential (E-score: 0.960) question?

Stock #

BB012

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

35497974-35535038 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 35515068 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Stop codon at position 103 (Q103*)

Ref Sequence

ENSEMBL: ENSMUSP00000112137 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000110811] [ENSMUST00000116436]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000110811

SMART Domains

Protein: ENSMUSP00000106434
Gene: ENSMUSG00000019256

Domain	Start	End	E-Value	Type
HLH	33	87	3.31e-6	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000116436
AA Change: Q103*

SMART Domains

Protein: ENSMUSP00000112137
Gene: ENSMUSG00000019256
AA Change: Q103*

Domain	Start	End	E-Value	Type
HLH	33	87	5.09e-7	SMART
PAS	111	177	2.72e-12	SMART
low complexity region	212	222	N/A	INTRINSIC
PAS	266	336	1.77e-2	SMART
PAC	342	383	2.39e-8	SMART
low complexity region	606	640	N/A	INTRINSIC

Meta Mutation Damage Score

0.9756

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: The protein encoded by this gene is a ligand-activated helix-loop-helix transcription factor involved in the regulation of biological responses to planar aromatic hydrocarbons. This receptor has been shown to regulate xenobiotic-metabolizing enzymes such as cytochrome P450. Before ligand binding, the encoded protein is sequestered in the cytoplasm; upon ligand binding, this protein moves to the nucleus and stimulates transcription of target genes. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for null or hypomorphic alleles do not respond to cyclic compounds (e.g., dioxin) and are resistant to their teratogenic effects. Depending on the allele, null mutants may also have liver defects, impaired female fertility, neonatal or postnatal lethality, and spleen abnormalities. [provided by MGI curators]

Allele List at MGI

All alleles(12) : Targeted, knock-out(2) Targeted, other(6) Other(4)

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930433I11Rik	C	T	7: 40,994,082	Q392*	probably null	Het
4933427D14Rik	A	C	11: 72,180,501	L473V	probably benign	Het
A930002H24Rik	A	T	17: 63,863,397	V132E	unknown	Het
Abcc2	A	G	19: 43,807,112	I436V	probably benign	Het
Asb15	T	A	6: 24,562,724	H228Q	probably benign	Het
Asphd1	T	A	7: 126,948,456	Y225F	probably damaging	Het
Atp2c1	A	G	9: 105,442,770	M468T	possibly damaging	Het
BC030499	T	C	11: 78,291,623	L86P	probably damaging	Het
Brca1	A	G	11: 101,508,146	I1540T	probably benign	Het
Cdh20	A	T	1: 104,984,748	I576F	probably damaging	Het
Chst11	T	A	10: 83,190,954	S72T	probably damaging	Het
Cldn17	T	G	16: 88,506,645	K65N	probably damaging	Het
Cldn22	T	C	8: 47,825,187	I220T	probably benign	Het
Coasy	T	G	11: 101,083,696	D229E	probably benign	Het
Colec10	T	C	15: 54,462,371	V199A	probably damaging	Het
Cpn2	G	T	16: 30,260,801	D27E	probably damaging	Het
F5	T	A	1: 164,176,366		probably null	Het
Fat3	C	T	9: 16,031,360	V1239I	possibly damaging	Het
Fbxl16	A	G	17: 25,816,906	N159S	probably benign	Het
Fhad1	A	G	4: 141,954,187	I514T	probably damaging	Het
Fras1	A	G	5: 96,781,584	K3949R	probably damaging	Het
Gm10800	AAAGAAAACTGAA	ACAAGAAAACTGAA	2: 98,667,033		probably null	Het
Grm3	T	A	5: 9,589,880	E55V	probably benign	Het
Itgbl1	G	A	14: 123,973,323	D478N	possibly damaging	Het
Kcnt2	T	A	1: 140,354,509	Y77*	probably null	Het
Kdm4c	T	C	4: 74,404,821	S997P	probably damaging	Het
Kti12	A	C	4: 108,848,246	E119A	probably benign	Het
Kti12	G	T	4: 108,848,247	E119D	probably benign	Het
Lrrc28	T	C	7: 67,619,109	Y71C	probably damaging	Het
Lrrc45	T	A	11: 120,715,880	W203R	probably benign	Het
Lrrc66	A	T	5: 73,608,492	C403S	possibly damaging	Het
Ly6g6e	A	T	17: 35,077,918	E45V	probably damaging	Het
Mgam	C	T	6: 40,759,051	T1574I	probably damaging	Het
Msrb2	A	T	2: 19,383,280	M80L	probably benign	Het
Musk	T	A	4: 58,367,513	L592Q	probably damaging	Het
Nlrp4a	C	A	7: 26,450,586	N539K	probably benign	Het
Obscn	C	G	11: 59,112,555	E1306Q	probably benign	Het
Olfr1006	T	C	2: 85,674,563	E196G		Het
Olfr1291-ps1	A	G	2: 111,499,821	S190G	probably damaging	Het
Olfr355	A	G	2: 36,927,359	F252L	possibly damaging	Het
Olfr388-ps1	A	G	11: 73,724,536	S163P	unknown	Het
Opalin	T	A	19: 41,063,803	*144C	probably null	Het
Pgam2	T	A	11: 5,803,007	H196L	possibly damaging	Het
Pgls	T	C	8: 71,592,352	S46P	probably damaging	Het
Prrc2b	A	G	2: 32,204,115	E503G	probably damaging	Het
Prss45	T	C	9: 110,841,035	L304P	unknown	Het
Rbm20	T	A	19: 53,813,322	V87D	probably damaging	Het
Serpinb8	T	C	1: 107,598,985	L85S	probably benign	Het
Sh2b2	A	T	5: 136,224,261	H352Q	probably benign	Het
Slc6a17	T	C	3: 107,495,740	I124V	probably damaging	Het
Smim10l1	G	A	6: 133,105,582	V31M	probably damaging	Het
Snx10	T	C	6: 51,580,321	S78P	probably benign	Het
Stard10	T	C	7: 101,342,631	V187A	probably damaging	Het
Svil	C	A	18: 5,118,357	D2146E	probably benign	Het
Tsc22d4	A	G	5: 137,751,365	D301G	probably null	Het
Ube3c	T	A	5: 29,646,431	I752N	probably damaging	Het
Wisp2	G	C	2: 163,829,041	R156T	possibly damaging	Het
Wwc1	T	C	11: 35,844,163	M962V	probably benign	Het

Other mutations in Ahr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00589:Ahr	APN	12	35504097	nonsense	probably null
IGL01336:Ahr	APN	12	35503840	missense	probably benign	0.19
IGL01972:Ahr	APN	12	35504449	missense	possibly damaging	0.89
IGL02117:Ahr	APN	12	35512923	nonsense	probably null
IGL03028:Ahr	APN	12	35504710	missense	probably benign
IGL03110:Ahr	APN	12	35504971	missense	probably damaging	0.98
IGL03394:Ahr	APN	12	35503752	nonsense	probably null
IGL03403:Ahr	APN	12	35504326	missense	possibly damaging	0.63
BB002:Ahr	UTSW	12	35515068	nonsense	probably null
R0620:Ahr	UTSW	12	35508194	missense	probably benign	0.26
R0784:Ahr	UTSW	12	35508142	missense	possibly damaging	0.79
R1133:Ahr	UTSW	12	35526806	missense	probably damaging	1.00
R1168:Ahr	UTSW	12	35504532	missense	possibly damaging	0.49
R4678:Ahr	UTSW	12	35507464	missense	probably damaging	1.00
R5615:Ahr	UTSW	12	35503885	missense	probably benign	0.01
R6066:Ahr	UTSW	12	35504921	missense	probably damaging	0.99
R6466:Ahr	UTSW	12	35504032	missense	probably benign	0.29
R7369:Ahr	UTSW	12	35504660	missense	possibly damaging	0.94
R7382:Ahr	UTSW	12	35504515	missense	probably damaging	1.00
R7685:Ahr	UTSW	12	35504017	missense	probably damaging	0.96
R7819:Ahr	UTSW	12	35510000	missense	probably damaging	1.00
R7897:Ahr	UTSW	12	35504170	missense	possibly damaging	0.47
R7925:Ahr	UTSW	12	35515068	nonsense	probably null
R8179:Ahr	UTSW	12	35510051	missense	probably benign	0.01
R8274:Ahr	UTSW	12	35510069	missense	probably benign
R8342:Ahr	UTSW	12	35508272	missense	probably damaging	1.00
R8985:Ahr	UTSW	12	35526737	missense	possibly damaging	0.91
R9114:Ahr	UTSW	12	35511165	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACTAGAGAAGACCAGTGCTGC -3'
(R):5'- TGGTAGCCATAACCACTGTGTTC -3'

Sequencing Primer
(F):5'- TGCTGCAGCTGACATGAAC -3'
(R):5'- GCCATAACCACTGTGTTCGGTTG -3'

Posted On

2020-08-01