Incidental Mutation 'R0051:Frrs1'
ID64274
Institutional Source Beutler Lab
Gene Symbol Frrs1
Ensembl Gene ENSMUSG00000033386
Gene Nameferric-chelate reductase 1
SynonymsSdfr2
MMRRC Submission 038345-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.163) question?
Stock #R0051 (G1)
Quality Score156
Status Validated
Chromosome3
Chromosomal Location116859464-116908177 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 116885297 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143546 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040260] [ENSMUST00000195905] [ENSMUST00000199626]
Predicted Effect probably benign
Transcript: ENSMUST00000040260
SMART Domains Protein: ENSMUSP00000039487
Gene: ENSMUSG00000033386

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Reeler 32 155 1.1e-34 PFAM
low complexity region 171 184 N/A INTRINSIC
DoH 242 331 7.72e-9 SMART
B561 372 501 1.87e-42 SMART
transmembrane domain 514 536 N/A INTRINSIC
transmembrane domain 570 589 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195905
SMART Domains Protein: ENSMUSP00000143255
Gene: ENSMUSG00000033386

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Reeler 31 156 4.6e-40 PFAM
low complexity region 171 184 N/A INTRINSIC
DoH 242 331 7.72e-9 SMART
B561 372 501 1.87e-42 SMART
transmembrane domain 514 536 N/A INTRINSIC
transmembrane domain 570 589 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199626
SMART Domains Protein: ENSMUSP00000143546
Gene: ENSMUSG00000033386

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 93.8%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the cytochrome b561 (CYB561; MIM 600019) family, including FRRS1, reduce ferric to ferrous iron before its transport from the endosome to the cytoplasm (Vargas et al., 2003 [PubMed 14499595]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik A G 7: 29,579,101 noncoding transcript Het
Abr T A 11: 76,472,502 Q163L probably benign Het
AI314180 A G 4: 58,832,729 L877S probably damaging Het
Ankrd11 C A 8: 122,889,742 C2457F probably damaging Het
Anks3 G C 16: 4,947,749 T163S probably benign Het
Cacna1d G A 14: 30,111,095 P908S probably damaging Het
Ccdc146 C A 5: 21,316,904 R374L possibly damaging Het
Cdc45 G T 16: 18,794,774 A348E probably damaging Het
Cfap46 A G 7: 139,676,035 C300R probably damaging Het
Coq2 T C 5: 100,663,685 N146S probably benign Het
Dalrd3 T C 9: 108,572,215 V120A possibly damaging Het
Dcp2 T A 18: 44,405,374 probably benign Het
Ddx39 A G 8: 83,720,622 K137R possibly damaging Het
Diaph3 A G 14: 87,037,454 probably null Het
Dmbt1 G T 7: 131,119,496 R1668L possibly damaging Het
Dnah7a T G 1: 53,521,086 probably benign Het
Dpp7 A G 2: 25,356,095 Y49H possibly damaging Het
Drd5 A G 5: 38,320,614 S317G probably benign Het
Ecsit C T 9: 22,076,288 V152I probably benign Het
Emc1 T A 4: 139,375,163 M923K possibly damaging Het
Fam102a G A 2: 32,558,053 R58Q possibly damaging Het
Fcrl6 A T 1: 172,598,753 L159Q probably benign Het
Hspd1 A G 1: 55,082,046 probably benign Het
Impg2 T A 16: 56,258,048 S458T probably damaging Het
Klf17 T C 4: 117,760,392 Y256C probably damaging Het
Lnx2 A G 5: 147,029,353 F319L probably damaging Het
Mafg G T 11: 120,629,604 R57S probably damaging Het
Med13l T A 5: 118,742,655 W1271R probably damaging Het
Mrgprb1 A G 7: 48,447,214 S24P probably benign Het
Mtrf1l T C 10: 5,813,384 E315G probably damaging Het
Naip1 T C 13: 100,411,001 E1239G probably damaging Het
Ncaph2 T C 15: 89,369,664 S320P probably damaging Het
Nek11 A G 9: 105,218,539 probably benign Het
Nlrp2 A T 7: 5,322,334 probably benign Het
Odf3 C A 7: 140,850,221 probably benign Het
Rbm26 A C 14: 105,152,540 V216G possibly damaging Het
Rnf115 A G 3: 96,785,022 D178G probably damaging Het
Rtel1 C T 2: 181,350,656 Q424* probably null Het
Rwdd4a A G 8: 47,537,365 probably benign Het
Ryr3 T C 2: 112,869,075 D890G probably damaging Het
Scarb1 C A 5: 125,281,100 probably null Het
Serpina10 A G 12: 103,626,897 probably benign Het
Slc12a5 T A 2: 164,986,663 W508R probably damaging Het
Slc43a2 T C 11: 75,562,850 C225R probably damaging Het
Slc6a9 T C 4: 117,864,859 F440L probably damaging Het
Stac3 G A 10: 127,508,148 R305H probably damaging Het
Stk32b A G 5: 37,459,596 probably benign Het
Syna A T 5: 134,559,543 L184H probably damaging Het
Tmprss7 T C 16: 45,673,939 N401S probably damaging Het
Yeats2 T A 16: 20,193,724 Y557* probably null Het
Zcchc11 T G 4: 108,527,004 S1089R probably damaging Het
Zfp352 T C 4: 90,224,285 S221P probably damaging Het
Zfp575 A G 7: 24,586,087 V43A probably benign Het
Zfp775 A G 6: 48,620,772 T527A probably benign Het
Other mutations in Frrs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00577:Frrs1 APN 3 116902400 missense probably damaging 1.00
IGL00792:Frrs1 APN 3 116885295 splice site probably null
IGL01395:Frrs1 APN 3 116901005 missense probably benign 0.02
IGL01504:Frrs1 APN 3 116900658 missense probably damaging 1.00
IGL01548:Frrs1 APN 3 116885185 missense probably damaging 1.00
IGL01924:Frrs1 APN 3 116885239 missense probably damaging 1.00
IGL03037:Frrs1 APN 3 116902467 unclassified probably benign
IGL03104:Frrs1 APN 3 116881782 missense probably benign 0.00
IGL03143:Frrs1 APN 3 116899187 missense probably damaging 0.99
R0023:Frrs1 UTSW 3 116896788 missense probably damaging 1.00
R0023:Frrs1 UTSW 3 116896788 missense probably damaging 1.00
R0051:Frrs1 UTSW 3 116885297 splice site probably benign
R0107:Frrs1 UTSW 3 116896716 missense probably damaging 0.97
R0138:Frrs1 UTSW 3 116881807 missense possibly damaging 0.65
R0532:Frrs1 UTSW 3 116883164 missense probably benign
R0646:Frrs1 UTSW 3 116902421 missense possibly damaging 0.50
R1534:Frrs1 UTSW 3 116878408 missense probably benign 0.14
R1596:Frrs1 UTSW 3 116883199 intron probably benign
R1880:Frrs1 UTSW 3 116896795 critical splice donor site probably null
R2193:Frrs1 UTSW 3 116878345 missense probably damaging 1.00
R2851:Frrs1 UTSW 3 116885129 missense probably benign 0.00
R3177:Frrs1 UTSW 3 116899224 missense probably damaging 1.00
R3277:Frrs1 UTSW 3 116899224 missense probably damaging 1.00
R3772:Frrs1 UTSW 3 116878387 missense possibly damaging 0.71
R4457:Frrs1 UTSW 3 116896728 missense probably benign 0.10
R4887:Frrs1 UTSW 3 116902416 makesense probably null
R4957:Frrs1 UTSW 3 116885248 missense probably benign 0.00
R5015:Frrs1 UTSW 3 116878439 missense probably damaging 1.00
R5080:Frrs1 UTSW 3 116902936 missense probably benign 0.02
R5256:Frrs1 UTSW 3 116903100 missense possibly damaging 0.88
R5280:Frrs1 UTSW 3 116880896 missense probably benign 0.00
R5597:Frrs1 UTSW 3 116878238 start gained probably benign
R5887:Frrs1 UTSW 3 116896750 missense probably benign 0.32
R6210:Frrs1 UTSW 3 116878431 missense probably benign 0.19
R6268:Frrs1 UTSW 3 116903099 missense probably damaging 0.98
R6378:Frrs1 UTSW 3 116900990 missense possibly damaging 0.95
R7165:Frrs1 UTSW 3 116878271 missense probably benign 0.18
R7220:Frrs1 UTSW 3 116880776 nonsense probably null
R7301:Frrs1 UTSW 3 116895563 missense possibly damaging 0.47
R7312:Frrs1 UTSW 3 116881777 missense probably damaging 1.00
R7862:Frrs1 UTSW 3 116891880 missense possibly damaging 0.83
R8032:Frrs1 UTSW 3 116878360 missense probably benign 0.00
R8114:Frrs1 UTSW 3 116881776 missense probably damaging 0.97
R8283:Frrs1 UTSW 3 116878303 missense probably benign 0.01
X0063:Frrs1 UTSW 3 116902422 missense possibly damaging 0.67
Z1177:Frrs1 UTSW 3 116881818 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TTCAGTGCCTTCGAGTGTGGGAAC -3'
(R):5'- ACTTGGCACACAGGAACGTAAGTC -3'

Sequencing Primer
(F):5'- CAAGAAGTTCTGTGTCAGGAGTC -3'
(R):5'- GCAGCCTGCTCTTAGAAATAACTG -3'
Posted On2013-08-06