Incidental Mutation 'BB012:Cpn2'
ID 642740
Institutional Source Beutler Lab
Gene Symbol Cpn2
Ensembl Gene ENSMUSG00000023176
Gene Name carboxypeptidase N, polypeptide 2
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock # BB012
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 30256378-30267499 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 30260801 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 27 (D27E)
Ref Sequence ENSEMBL: ENSMUSP00000069318 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064856]
AlphaFold Q9DBB9
Predicted Effect probably damaging
Transcript: ENSMUST00000064856
AA Change: D27E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000069318
Gene: ENSMUSG00000023176
AA Change: D27E

DomainStartEndE-ValueType
LRRNT 21 53 3.21e-8 SMART
LRR 96 119 1.22e2 SMART
LRR 120 143 5.11e0 SMART
LRR_TYP 144 167 2.71e-2 SMART
LRR_TYP 168 191 3.21e-4 SMART
LRR_TYP 192 215 5.9e-3 SMART
LRR_TYP 216 239 6.88e-4 SMART
LRR 240 263 6.57e-1 SMART
LRR_TYP 264 287 2.12e-4 SMART
LRR 289 311 3.07e-1 SMART
LRR_TYP 312 335 2.61e-4 SMART
LRR_TYP 336 359 5.9e-3 SMART
LRR_TYP 360 383 2.79e-4 SMART
LRRCT 395 446 7.34e-9 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik C T 7: 40,994,082 Q392* probably null Het
4933427D14Rik A C 11: 72,180,501 L473V probably benign Het
A930002H24Rik A T 17: 63,863,397 V132E unknown Het
Abcc2 A G 19: 43,807,112 I436V probably benign Het
Ahr G A 12: 35,515,068 Q103* probably null Het
Asb15 T A 6: 24,562,724 H228Q probably benign Het
Asphd1 T A 7: 126,948,456 Y225F probably damaging Het
Atp2c1 A G 9: 105,442,770 M468T possibly damaging Het
BC030499 T C 11: 78,291,623 L86P probably damaging Het
Brca1 A G 11: 101,508,146 I1540T probably benign Het
Cdh20 A T 1: 104,984,748 I576F probably damaging Het
Chst11 T A 10: 83,190,954 S72T probably damaging Het
Cldn17 T G 16: 88,506,645 K65N probably damaging Het
Cldn22 T C 8: 47,825,187 I220T probably benign Het
Coasy T G 11: 101,083,696 D229E probably benign Het
Colec10 T C 15: 54,462,371 V199A probably damaging Het
F5 T A 1: 164,176,366 probably null Het
Fat3 C T 9: 16,031,360 V1239I possibly damaging Het
Fbxl16 A G 17: 25,816,906 N159S probably benign Het
Fhad1 A G 4: 141,954,187 I514T probably damaging Het
Fras1 A G 5: 96,781,584 K3949R probably damaging Het
Gm10800 AAAGAAAACTGAA ACAAGAAAACTGAA 2: 98,667,033 probably null Het
Grm3 T A 5: 9,589,880 E55V probably benign Het
Itgbl1 G A 14: 123,973,323 D478N possibly damaging Het
Kcnt2 T A 1: 140,354,509 Y77* probably null Het
Kdm4c T C 4: 74,404,821 S997P probably damaging Het
Kti12 A C 4: 108,848,246 E119A probably benign Het
Kti12 G T 4: 108,848,247 E119D probably benign Het
Lrrc28 T C 7: 67,619,109 Y71C probably damaging Het
Lrrc45 T A 11: 120,715,880 W203R probably benign Het
Lrrc66 A T 5: 73,608,492 C403S possibly damaging Het
Ly6g6e A T 17: 35,077,918 E45V probably damaging Het
Mgam C T 6: 40,759,051 T1574I probably damaging Het
Msrb2 A T 2: 19,383,280 M80L probably benign Het
Musk T A 4: 58,367,513 L592Q probably damaging Het
Nlrp4a C A 7: 26,450,586 N539K probably benign Het
Obscn C G 11: 59,112,555 E1306Q probably benign Het
Olfr1006 T C 2: 85,674,563 E196G Het
Olfr1291-ps1 A G 2: 111,499,821 S190G probably damaging Het
Olfr355 A G 2: 36,927,359 F252L possibly damaging Het
Olfr388-ps1 A G 11: 73,724,536 S163P unknown Het
Opalin T A 19: 41,063,803 *144C probably null Het
Pgam2 T A 11: 5,803,007 H196L possibly damaging Het
Pgls T C 8: 71,592,352 S46P probably damaging Het
Prrc2b A G 2: 32,204,115 E503G probably damaging Het
Prss45 T C 9: 110,841,035 L304P unknown Het
Rbm20 T A 19: 53,813,322 V87D probably damaging Het
Serpinb8 T C 1: 107,598,985 L85S probably benign Het
Sh2b2 A T 5: 136,224,261 H352Q probably benign Het
Slc6a17 T C 3: 107,495,740 I124V probably damaging Het
Smim10l1 G A 6: 133,105,582 V31M probably damaging Het
Snx10 T C 6: 51,580,321 S78P probably benign Het
Stard10 T C 7: 101,342,631 V187A probably damaging Het
Svil C A 18: 5,118,357 D2146E probably benign Het
Tsc22d4 A G 5: 137,751,365 D301G probably null Het
Ube3c T A 5: 29,646,431 I752N probably damaging Het
Wisp2 G C 2: 163,829,041 R156T possibly damaging Het
Wwc1 T C 11: 35,844,163 M962V probably benign Het
Other mutations in Cpn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00895:Cpn2 APN 16 30260520 missense probably benign 0.42
IGL01954:Cpn2 APN 16 30260320 missense probably benign 0.01
IGL02458:Cpn2 APN 16 30260835 missense probably benign 0.00
IGL03036:Cpn2 APN 16 30260829 missense probably benign 0.00
BB002:Cpn2 UTSW 16 30260801 missense probably damaging 1.00
R0118:Cpn2 UTSW 16 30260368 missense probably benign 0.04
R0541:Cpn2 UTSW 16 30259351 missense possibly damaging 0.73
R1300:Cpn2 UTSW 16 30259663 missense probably benign 0.01
R1470:Cpn2 UTSW 16 30260185 missense probably benign 0.00
R1470:Cpn2 UTSW 16 30260185 missense probably benign 0.00
R1751:Cpn2 UTSW 16 30259667 nonsense probably null
R1753:Cpn2 UTSW 16 30260100 missense probably damaging 1.00
R1761:Cpn2 UTSW 16 30260196 missense probably damaging 1.00
R1767:Cpn2 UTSW 16 30259667 nonsense probably null
R1793:Cpn2 UTSW 16 30259324 missense probably damaging 1.00
R2360:Cpn2 UTSW 16 30259503 missense probably benign 0.01
R2414:Cpn2 UTSW 16 30260574 missense probably benign 0.41
R3842:Cpn2 UTSW 16 30260518 missense probably damaging 1.00
R4934:Cpn2 UTSW 16 30260526 missense probably damaging 1.00
R4956:Cpn2 UTSW 16 30260415 missense possibly damaging 0.56
R5593:Cpn2 UTSW 16 30260080 missense probably benign 0.02
R5864:Cpn2 UTSW 16 30259683 missense probably damaging 1.00
R6755:Cpn2 UTSW 16 30260331 missense probably damaging 1.00
R7833:Cpn2 UTSW 16 30260345 missense probably damaging 1.00
R7925:Cpn2 UTSW 16 30260801 missense probably damaging 1.00
R8441:Cpn2 UTSW 16 30260031 missense probably damaging 1.00
R8679:Cpn2 UTSW 16 30259267 missense possibly damaging 0.90
R8844:Cpn2 UTSW 16 30259297 missense probably damaging 1.00
R9406:Cpn2 UTSW 16 30259542 missense probably benign 0.02
R9523:Cpn2 UTSW 16 30259941 missense possibly damaging 0.89
RF021:Cpn2 UTSW 16 30259338 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGAGCTTCTCCAGTGAGCTC -3'
(R):5'- CCGTTTAGTGATCTGGGCAC -3'

Sequencing Primer
(F):5'- CTCCAGTGAGCTCAGGTTAG -3'
(R):5'- TGATCTGGGCACTGCACTATGAC -3'
Posted On 2020-08-01