Incidental Mutation 'BB013:Ttc41'
ID 642765
Institutional Source Beutler Lab
Gene Symbol Ttc41
Ensembl Gene ENSMUSG00000044937
Gene Name tetratricopeptide repeat domain 41
Synonyms Gnn, BC030307
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock # BB013
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 86705811-86776844 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 86776047 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1093 (E1093G)
Ref Sequence ENSEMBL: ENSMUSP00000075059 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075632] [ENSMUST00000099396]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000075632
AA Change: E1093G

PolyPhen 2 Score 0.104 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000075059
Gene: ENSMUSG00000044937
AA Change: E1093G

DomainStartEndE-ValueType
low complexity region 216 229 N/A INTRINSIC
low complexity region 307 315 N/A INTRINSIC
Pfam:NACHT 337 515 5.4e-10 PFAM
SCOP:d1qqea_ 805 1028 2e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000099396
SMART Domains Protein: ENSMUSP00000096994
Gene: ENSMUSG00000054027

DomainStartEndE-ValueType
low complexity region 5 25 N/A INTRINSIC
Pfam:5_nucleotid 83 526 1.8e-159 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000218802
Predicted Effect probably benign
Transcript: ENSMUST00000219476
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adprhl1 C T 8: 13,248,682 V83I probably damaging Het
BC016579 C A 16: 45,629,462 D198Y probably damaging Het
Cep170 A G 1: 176,761,413 S549P probably damaging Het
Cnih3 T C 1: 181,450,001 L96P probably damaging Het
Cnn2 T A 10: 79,993,326 L168Q probably damaging Het
Cnot1 ACG A 8: 95,745,647 probably null Het
Cnot10 A G 9: 114,617,815 C398R probably damaging Het
Dcaf4 C A 12: 83,533,929 Y212* probably null Het
Dmxl2 T C 9: 54,428,042 T665A probably benign Het
Dnmt1 C A 9: 20,907,559 A1609S unknown Het
Dzip1 T C 14: 118,883,499 D682G probably benign Het
Fam76a A G 4: 132,902,094 L249P probably damaging Het
Fgf10 T C 13: 118,789,216 M177T probably damaging Het
G530012D18Rik C G 1: 85,577,214 D113E unknown Het
Gm340 T C 19: 41,582,569 F67S probably benign Het
Itln1 G A 1: 171,531,693 T73I probably benign Het
Jkamp T C 12: 72,094,816 Y197H probably damaging Het
Kti12 A C 4: 108,848,246 E119A probably benign Het
Kti12 G T 4: 108,848,247 E119D probably benign Het
Lmf2 G A 15: 89,352,421 P514L probably damaging Het
Lmntd2 G T 7: 141,210,345 P610Q probably damaging Het
Map3k3 T C 11: 106,145,722 S225P probably damaging Het
Mbd5 T C 2: 49,256,323 Y182H probably damaging Het
Mki67 A G 7: 135,697,140 V2055A possibly damaging Het
Mtmr7 G A 8: 40,606,884 A62V possibly damaging Het
Myh8 C T 11: 67,278,906 P17L possibly damaging Het
Myt1l T A 12: 29,811,652 D144E unknown Het
Nfatc1 T C 18: 80,697,666 Y373C probably damaging Het
Pacs2 C T 12: 113,060,752 L418F probably damaging Het
Paxip1 A G 5: 27,791,209 I24T unknown Het
Pdcl C T 2: 37,352,237 G167E probably damaging Het
Pdcl A C 2: 37,352,239 S166R probably damaging Het
Qsox1 C T 1: 155,812,787 G5S unknown Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Sass6 T A 3: 116,628,770 S641T possibly damaging Het
Six1 T C 12: 73,043,809 N194S probably benign Het
Tagap T C 17: 7,926,938 probably null Het
Tiparp T C 3: 65,553,525 V645A possibly damaging Het
Tm2d2 T C 8: 25,020,464 V113A probably damaging Het
Tmprss6 C A 15: 78,452,850 R352L probably benign Het
Tslp A G 18: 32,817,193 E105G possibly damaging Het
Ush2a G A 1: 188,728,600 R2686H probably benign Het
Usp54 A T 14: 20,576,968 Y541N probably damaging Het
Vmn2r125 A G 4: 156,350,693 D122G probably damaging Het
Other mutations in Ttc41
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00846:Ttc41 APN 10 86736933 missense possibly damaging 0.71
IGL01373:Ttc41 APN 10 86775957 missense possibly damaging 0.61
IGL01636:Ttc41 APN 10 86776678 missense probably benign
IGL01707:Ttc41 APN 10 86776767 missense probably damaging 1.00
IGL01814:Ttc41 APN 10 86731026 missense probably damaging 0.98
IGL01845:Ttc41 APN 10 86776624 missense probably benign 0.03
IGL01918:Ttc41 APN 10 86713190 missense probably damaging 1.00
IGL02374:Ttc41 APN 10 86775951 missense probably damaging 1.00
IGL02489:Ttc41 APN 10 86760914 nonsense probably null
IGL02887:Ttc41 APN 10 86733654 missense probably damaging 1.00
IGL03061:Ttc41 APN 10 86736857 missense possibly damaging 0.65
IGL03077:Ttc41 APN 10 86758348 missense probably damaging 1.00
IGL03210:Ttc41 APN 10 86724414 critical splice donor site probably null
IGL03242:Ttc41 APN 10 86776819 makesense probably null
IGL03307:Ttc41 APN 10 86744440 missense possibly damaging 0.76
BB003:Ttc41 UTSW 10 86776047 missense probably benign 0.10
R0071:Ttc41 UTSW 10 86736846 missense probably benign 0.01
R0071:Ttc41 UTSW 10 86736846 missense probably benign 0.01
R0379:Ttc41 UTSW 10 86712977 missense possibly damaging 0.65
R0384:Ttc41 UTSW 10 86763947 missense probably damaging 1.00
R0545:Ttc41 UTSW 10 86759097 missense probably benign 0.00
R1589:Ttc41 UTSW 10 86776390 missense probably benign 0.01
R1599:Ttc41 UTSW 10 86776573 missense probably benign 0.04
R1608:Ttc41 UTSW 10 86775993 missense probably damaging 1.00
R1670:Ttc41 UTSW 10 86776252 missense possibly damaging 0.93
R1938:Ttc41 UTSW 10 86776214 missense probably benign
R2398:Ttc41 UTSW 10 86713386 missense possibly damaging 0.91
R2401:Ttc41 UTSW 10 86724374 missense probably benign 0.42
R3117:Ttc41 UTSW 10 86724320 missense possibly damaging 0.62
R3119:Ttc41 UTSW 10 86724320 missense possibly damaging 0.62
R4805:Ttc41 UTSW 10 86729798 missense possibly damaging 0.62
R4840:Ttc41 UTSW 10 86731125 missense probably benign 0.10
R4841:Ttc41 UTSW 10 86731125 missense probably benign 0.10
R4842:Ttc41 UTSW 10 86731125 missense probably benign 0.10
R4884:Ttc41 UTSW 10 86731018 missense probably benign 0.00
R4885:Ttc41 UTSW 10 86759102 missense possibly damaging 0.76
R4898:Ttc41 UTSW 10 86776192 missense possibly damaging 0.80
R5067:Ttc41 UTSW 10 86744544 missense probably damaging 0.96
R5253:Ttc41 UTSW 10 86730942 missense probably benign 0.13
R5268:Ttc41 UTSW 10 86744478 missense possibly damaging 0.76
R5297:Ttc41 UTSW 10 86776579 missense probably benign 0.04
R5301:Ttc41 UTSW 10 86719520 missense probably benign 0.00
R5425:Ttc41 UTSW 10 86776630 missense probably damaging 0.96
R5567:Ttc41 UTSW 10 86760920 critical splice donor site probably null
R5635:Ttc41 UTSW 10 86736977 missense probably benign 0.09
R5752:Ttc41 UTSW 10 86758346 missense probably benign 0.33
R5868:Ttc41 UTSW 10 86750264 missense possibly damaging 0.70
R5948:Ttc41 UTSW 10 86713224 missense probably damaging 1.00
R6116:Ttc41 UTSW 10 86759088 critical splice acceptor site probably null
R6247:Ttc41 UTSW 10 86776663 missense probably benign 0.00
R6260:Ttc41 UTSW 10 86731159 missense probably benign 0.20
R6260:Ttc41 UTSW 10 86733707 missense probably benign 0.32
R6276:Ttc41 UTSW 10 86744449 missense probably benign 0.01
R6458:Ttc41 UTSW 10 86758270 missense possibly damaging 0.45
R7170:Ttc41 UTSW 10 86713503 missense probably benign 0.17
R7348:Ttc41 UTSW 10 86750348 nonsense probably null
R7382:Ttc41 UTSW 10 86776510 missense probably damaging 0.97
R7509:Ttc41 UTSW 10 86713432 missense probably damaging 1.00
R7689:Ttc41 UTSW 10 86759224 missense probably damaging 1.00
R7807:Ttc41 UTSW 10 86776631 missense probably benign 0.02
R7926:Ttc41 UTSW 10 86776047 missense probably benign 0.10
R7998:Ttc41 UTSW 10 86736847 missense probably benign 0.01
R8021:Ttc41 UTSW 10 86733714 missense probably benign
R8059:Ttc41 UTSW 10 86712978 missense probably benign 0.01
R8170:Ttc41 UTSW 10 86776166 missense probably damaging 1.00
R8303:Ttc41 UTSW 10 86719630 missense probably benign 0.06
R8375:Ttc41 UTSW 10 86763980 missense probably damaging 0.97
R8383:Ttc41 UTSW 10 86719526 missense probably benign 0.00
R8698:Ttc41 UTSW 10 86712977 missense probably benign 0.00
R8773:Ttc41 UTSW 10 86729815 missense probably benign 0.35
R8902:Ttc41 UTSW 10 86713001 missense probably benign 0.06
R8985:Ttc41 UTSW 10 86731092 missense possibly damaging 0.80
R8988:Ttc41 UTSW 10 86713735 missense possibly damaging 0.88
R9007:Ttc41 UTSW 10 86733761 missense probably damaging 1.00
R9137:Ttc41 UTSW 10 86776622 missense probably benign 0.22
R9236:Ttc41 UTSW 10 86776730 missense probably damaging 1.00
R9248:Ttc41 UTSW 10 86731249 missense probably benign 0.00
R9287:Ttc41 UTSW 10 86763966 missense probably benign 0.43
R9345:Ttc41 UTSW 10 86759225 missense probably damaging 0.99
R9386:Ttc41 UTSW 10 86713026 missense probably damaging 0.99
X0024:Ttc41 UTSW 10 86724250 missense probably damaging 1.00
X0064:Ttc41 UTSW 10 86729797 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCTCTGATGCTGGCCTTATAAATC -3'
(R):5'- GCCATTCCTAGAACCGTTAGG -3'

Sequencing Primer
(F):5'- TGCTGGCCTTATAAATCTTTTACATG -3'
(R):5'- CCATTCCTAGAACCGTTAGGGAATAG -3'
Posted On 2020-08-01