Incidental Mutation 'R0051:Slc6a9'
ID64278
Institutional Source Beutler Lab
Gene Symbol Slc6a9
Ensembl Gene ENSMUSG00000028542
Gene Namesolute carrier family 6 (neurotransmitter transporter, glycine), member 9
SynonymsGlyt1, Glyt-1
MMRRC Submission 038345-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0051 (G1)
Quality Score119
Status Validated
Chromosome4
Chromosomal Location117834506-117875198 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 117864859 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 440 (F440L)
Ref Sequence ENSEMBL: ENSMUSP00000127289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030269] [ENSMUST00000063857] [ENSMUST00000084325] [ENSMUST00000106422] [ENSMUST00000132043] [ENSMUST00000149168] [ENSMUST00000163288] [ENSMUST00000164853] [ENSMUST00000167287] [ENSMUST00000169885] [ENSMUST00000169990] [ENSMUST00000171052]
Predicted Effect probably damaging
Transcript: ENSMUST00000030269
AA Change: F436L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030269
Gene: ENSMUSG00000028542
AA Change: F436L

DomainStartEndE-ValueType
Pfam:SNF 27 562 5.1e-234 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000063857
AA Change: F436L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066102
Gene: ENSMUSG00000028542
AA Change: F436L

DomainStartEndE-ValueType
Pfam:SNF 27 562 5.1e-234 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000084325
SMART Domains Protein: ENSMUSP00000081352
Gene: ENSMUSG00000028541

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Glyco_transf_7N 94 230 1.9e-47 PFAM
Pfam:Glyco_transf_7C 232 310 2.6e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106422
SMART Domains Protein: ENSMUSP00000102030
Gene: ENSMUSG00000078588

DomainStartEndE-ValueType
low complexity region 17 46 N/A INTRINSIC
coiled coil region 133 158 N/A INTRINSIC
low complexity region 254 266 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130758
Predicted Effect probably benign
Transcript: ENSMUST00000132043
SMART Domains Protein: ENSMUSP00000122676
Gene: ENSMUSG00000028542

DomainStartEndE-ValueType
Pfam:SNF 32 321 1.4e-132 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149168
SMART Domains Protein: ENSMUSP00000129359
Gene: ENSMUSG00000028542

DomainStartEndE-ValueType
low complexity region 91 116 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154439
Predicted Effect probably damaging
Transcript: ENSMUST00000163288
AA Change: F440L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127289
Gene: ENSMUSG00000028542
AA Change: F440L

DomainStartEndE-ValueType
Pfam:SNF 46 566 2.1e-212 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163974
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164716
Predicted Effect probably benign
Transcript: ENSMUST00000164853
SMART Domains Protein: ENSMUSP00000132114
Gene: ENSMUSG00000078588

DomainStartEndE-ValueType
low complexity region 17 46 N/A INTRINSIC
coiled coil region 133 158 N/A INTRINSIC
low complexity region 254 266 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167287
SMART Domains Protein: ENSMUSP00000126161
Gene: ENSMUSG00000078588

DomainStartEndE-ValueType
coiled coil region 13 38 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169885
AA Change: F324L

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000127093
Gene: ENSMUSG00000028542
AA Change: F324L

DomainStartEndE-ValueType
Pfam:SNF 1 450 1.2e-182 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169990
SMART Domains Protein: ENSMUSP00000127203
Gene: ENSMUSG00000028542

DomainStartEndE-ValueType
Pfam:SNF 84 373 2.3e-132 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171052
SMART Domains Protein: ENSMUSP00000129502
Gene: ENSMUSG00000078588

DomainStartEndE-ValueType
Pfam:CCDC24 21 201 3.9e-67 PFAM
low complexity region 282 294 N/A INTRINSIC
Meta Mutation Damage Score 0.6496 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 93.8%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The amino acid glycine acts as an inhibitory neurotransmitter in the central nervous system. The protein encoded by this gene is one of two transporters that stop glycine signaling by removing it from the synaptic cleft. [provided by RefSeq, Jun 2016]
PHENOTYPE: Homozygous null mice die shortly after birth exhibiting breathing and movement deficiencies. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik A G 7: 29,579,101 noncoding transcript Het
Abr T A 11: 76,472,502 Q163L probably benign Het
AI314180 A G 4: 58,832,729 L877S probably damaging Het
Ankrd11 C A 8: 122,889,742 C2457F probably damaging Het
Anks3 G C 16: 4,947,749 T163S probably benign Het
Cacna1d G A 14: 30,111,095 P908S probably damaging Het
Ccdc146 C A 5: 21,316,904 R374L possibly damaging Het
Cdc45 G T 16: 18,794,774 A348E probably damaging Het
Cfap46 A G 7: 139,676,035 C300R probably damaging Het
Coq2 T C 5: 100,663,685 N146S probably benign Het
Dalrd3 T C 9: 108,572,215 V120A possibly damaging Het
Dcp2 T A 18: 44,405,374 probably benign Het
Ddx39 A G 8: 83,720,622 K137R possibly damaging Het
Diaph3 A G 14: 87,037,454 probably null Het
Dmbt1 G T 7: 131,119,496 R1668L possibly damaging Het
Dnah7a T G 1: 53,521,086 probably benign Het
Dpp7 A G 2: 25,356,095 Y49H possibly damaging Het
Drd5 A G 5: 38,320,614 S317G probably benign Het
Ecsit C T 9: 22,076,288 V152I probably benign Het
Emc1 T A 4: 139,375,163 M923K possibly damaging Het
Fam102a G A 2: 32,558,053 R58Q possibly damaging Het
Fcrl6 A T 1: 172,598,753 L159Q probably benign Het
Frrs1 T C 3: 116,885,297 probably benign Het
Hspd1 A G 1: 55,082,046 probably benign Het
Impg2 T A 16: 56,258,048 S458T probably damaging Het
Klf17 T C 4: 117,760,392 Y256C probably damaging Het
Lnx2 A G 5: 147,029,353 F319L probably damaging Het
Mafg G T 11: 120,629,604 R57S probably damaging Het
Med13l T A 5: 118,742,655 W1271R probably damaging Het
Mrgprb1 A G 7: 48,447,214 S24P probably benign Het
Mtrf1l T C 10: 5,813,384 E315G probably damaging Het
Naip1 T C 13: 100,411,001 E1239G probably damaging Het
Ncaph2 T C 15: 89,369,664 S320P probably damaging Het
Nek11 A G 9: 105,218,539 probably benign Het
Nlrp2 A T 7: 5,322,334 probably benign Het
Odf3 C A 7: 140,850,221 probably benign Het
Rbm26 A C 14: 105,152,540 V216G possibly damaging Het
Rnf115 A G 3: 96,785,022 D178G probably damaging Het
Rtel1 C T 2: 181,350,656 Q424* probably null Het
Rwdd4a A G 8: 47,537,365 probably benign Het
Ryr3 T C 2: 112,869,075 D890G probably damaging Het
Scarb1 C A 5: 125,281,100 probably null Het
Serpina10 A G 12: 103,626,897 probably benign Het
Slc12a5 T A 2: 164,986,663 W508R probably damaging Het
Slc43a2 T C 11: 75,562,850 C225R probably damaging Het
Stac3 G A 10: 127,508,148 R305H probably damaging Het
Stk32b A G 5: 37,459,596 probably benign Het
Syna A T 5: 134,559,543 L184H probably damaging Het
Tmprss7 T C 16: 45,673,939 N401S probably damaging Het
Yeats2 T A 16: 20,193,724 Y557* probably null Het
Zcchc11 T G 4: 108,527,004 S1089R probably damaging Het
Zfp352 T C 4: 90,224,285 S221P probably damaging Het
Zfp575 A G 7: 24,586,087 V43A probably benign Het
Zfp775 A G 6: 48,620,772 T527A probably benign Het
Other mutations in Slc6a9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Slc6a9 APN 4 117864617 missense probably damaging 1.00
IGL01728:Slc6a9 APN 4 117864605 missense probably damaging 1.00
IGL02111:Slc6a9 APN 4 117864013 missense probably benign 0.19
R0051:Slc6a9 UTSW 4 117864859 missense probably damaging 1.00
R1170:Slc6a9 UTSW 4 117864806 missense possibly damaging 0.77
R2872:Slc6a9 UTSW 4 117849381 start codon destroyed probably null 0.02
R2872:Slc6a9 UTSW 4 117849381 start codon destroyed probably null 0.02
R3499:Slc6a9 UTSW 4 117856803 missense probably benign 0.01
R4744:Slc6a9 UTSW 4 117867895 missense probably benign 0.00
R4970:Slc6a9 UTSW 4 117856008 missense probably damaging 1.00
R5055:Slc6a9 UTSW 4 117868150 unclassified probably null
R5103:Slc6a9 UTSW 4 117868155 missense probably benign
R5726:Slc6a9 UTSW 4 117864013 missense probably damaging 1.00
R6836:Slc6a9 UTSW 4 117867886 missense possibly damaging 0.49
R7030:Slc6a9 UTSW 4 117857436 missense possibly damaging 0.94
R7061:Slc6a9 UTSW 4 117868064 missense probably benign 0.40
R7278:Slc6a9 UTSW 4 117868106 missense probably benign 0.31
R7863:Slc6a9 UTSW 4 117864010 missense probably damaging 1.00
R7946:Slc6a9 UTSW 4 117864010 missense probably damaging 1.00
R8036:Slc6a9 UTSW 4 117867886 missense possibly damaging 0.49
Z1176:Slc6a9 UTSW 4 117857366 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGAAGCAAGCTGGGTCTCCTAAAC -3'
(R):5'- TTGTCCATCAGCAGCAGCCAGTAG -3'

Sequencing Primer
(F):5'- ACTCAGGTATGGGgtgtgtg -3'
(R):5'- CAGTAGATGCCTGCCTGTG -3'
Posted On2013-08-06