Mutagenetix > Incidental Mutation

Incidental Mutation 'BB014:Cntnap2'

642807

Institutional Source

Beutler Lab

Gene Symbol

Cntnap2

Ensembl Gene

ENSMUSG00000039419

Gene Name

contactin associated protein-like 2

Synonyms

5430425M22Rik, Caspr2

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

BB014

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

45059357-47304213 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 47095687 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Phenylalanine at position 1063 (C1063F)

Ref Sequence

ENSEMBL: ENSMUSP00000110288 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000114641] [ENSMUST00000150737]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000114641
AA Change: C1063F

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000110288
Gene: ENSMUSG00000039419
AA Change: C1063F

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
FA58C	34	181	3.99e-22	SMART
LamG	208	345	5.5e-34	SMART
LamG	393	529	3.31e-28	SMART
EGF	557	591	5.04e-2	SMART
Blast:FBG	594	777	7e-68	BLAST
LamG	819	945	5.58e-35	SMART
EGF	966	1002	2.11e1	SMART
LamG	1048	1188	3.55e-28	SMART
low complexity region	1263	1273	N/A	INTRINSIC
4.1m	1283	1301	4.21e-7	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000150737

SMART Domains

Protein: ENSMUSP00000142656
Gene: ENSMUSG00000039419

Domain	Start	End	E-Value	Type
EGF	25	61	1e-1	SMART

Meta Mutation Damage Score

0.4580

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurexin family which functions in the vertebrate nervous system as cell adhesion molecules and receptors. This protein, like other neurexin proteins, contains epidermal growth factor repeats and laminin G domains. In addition, it includes an F5/8 type C domain, discoidin/neuropilin- and fibrinogen-like domains, thrombospondin N-terminal-like domains and a putative PDZ binding site. This protein is localized at the juxtaparanodes of myelinated axons, and mediates interactions between neurons and glia during nervous system development and is also involved in localization of potassium channels within differentiating axons. This gene encompasses almost 1.5% of chromosome 7 and is one of the largest genes in the human genome. It is directly bound and regulated by forkhead box protein P2 (FOXP2), a transcription factor related to speech and language development. This gene has been implicated in multiple neurodevelopmental disorders, including Gilles de la Tourette syndrome, schizophrenia, epilepsy, autism, ADHD and mental retardation.[provided by RefSeq, Mar 2010]
PHENOTYPE: Inactivation of this gene results in molecular abnormalities within the central nervous system, but homozygous mutant mice show no overt phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110051M20Rik	T	A	2: 91,421,905	D37V	probably damaging	Het
4921539E11Rik	A	G	4: 103,266,342	M111T	probably benign	Het
Adprhl1	C	T	8: 13,248,682	V83I	probably damaging	Het
Agrn	C	T	4: 156,172,809	G1188D	probably damaging	Het
Amz2	A	G	11: 109,429,058	K90R	probably damaging	Het
Arhgef4	G	T	1: 34,807,253	Q227H	probably damaging	Het
B4galt3	T	A	1: 171,271,772	C10*	probably null	Het
Banf2	T	A	2: 144,073,798	M53K	probably benign	Het
BC034090	A	T	1: 155,241,625	L249*	probably null	Het
Cftr	A	G	6: 18,267,971	D673G	possibly damaging	Het
Dnah3	A	G	7: 119,951,271	I296T	probably damaging	Het
Dpy19l2	A	G	9: 24,695,901	V88A	probably benign	Het
Fbln5	T	C	12: 101,818,388		probably benign	Het
Fbn1	T	C	2: 125,383,736	D532G	possibly damaging	Het
Fnta	G	A	8: 26,004,426	R258*	probably null	Het
Gch1	G	A	14: 47,155,923	H201Y	probably damaging	Het
Gm13023	T	A	4: 143,792,966	I99N	probably benign	Het
Grik2	A	T	10: 49,240,794	S624T	probably damaging	Het
Grm5	T	A	7: 88,036,174	S500T	probably benign	Het
Hmcn1	T	A	1: 150,609,775	I4359F	probably damaging	Het
Hrc	T	A	7: 45,336,053	H209Q	possibly damaging	Het
Hsd17b14	T	C	7: 45,565,971	M164T	probably damaging	Het
Hydin	T	C	8: 110,580,844	F3952L	possibly damaging	Het
Kti12	A	C	4: 108,848,246	E119A	probably benign	Het
Kti12	G	T	4: 108,848,247	E119D	probably benign	Het
Lig4	A	T	8: 9,973,629	H50Q	possibly damaging	Het
Lrp6	G	T	6: 134,520,550	R165S	probably damaging	Het
Muc4	A	G	16: 32,771,637	T958A		Het
Myo19	A	G	11: 84,900,220	E419G	probably damaging	Het
Ndufa5	A	G	6: 24,527,292	V16A	possibly damaging	Het
Olfr714	T	C	7: 107,074,289	F154L	probably benign	Het
Phf24	A	C	4: 42,934,774	T137P	probably damaging	Het
Pkp4	A	T	2: 59,311,754	N467I	probably damaging	Het
Rbm12b2	C	T	4: 12,095,417	R759C	possibly damaging	Het
Rftn1	G	T	17: 50,047,380	A318D	probably damaging	Het
Rnf34	T	A	5: 122,850,225		probably benign	Het
Rsf1	GGCGGCGGC	GGCGGCGGCAGCGGCGGC	7: 97,579,924		probably benign	Het
Scaf8	T	A	17: 3,159,220	S73T	unknown	Het
Scn4a	T	A	11: 106,342,383	E454D	probably damaging	Het
Serpina1e	A	G	12: 103,951,191	V73A	probably benign	Het
Sh3rf2	A	G	18: 42,111,422	T350A	probably benign	Het
Slc35a1	A	G	4: 34,669,021	V264A	probably damaging	Het
Slf2	A	G	19: 44,935,301	K185E	probably damaging	Het
Spsb2	T	C	6: 124,809,373	F23S	probably benign	Het
Ssx2ip	T	G	3: 146,432,610	L404R	probably damaging	Het
Strn4	T	A	7: 16,826,631	L236Q	probably null	Het
Tcp10b	A	G	17: 13,069,692	T202A	probably benign	Het
Tdp1	G	T	12: 99,912,296	V448L	probably damaging	Het
Tecrl	T	C	5: 83,354,819	E61G	probably damaging	Het
Tepp	T	A	8: 95,313,158	S68T	probably benign	Het
Trim50	T	C	5: 135,353,611	F106L	probably benign	Het
Usp5	G	T	6: 124,824,229	F224L	probably benign	Het
Vmn2r45	C	A	7: 8,483,514	M258I	probably benign	Het
Zfp574	T	A	7: 25,080,147	V198E	probably benign	Het
Zmym4	A	G	4: 126,905,377	I722T	probably benign	Het

Other mutations in Cntnap2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00509:Cntnap2	APN	6	46015263	missense	possibly damaging	0.92
IGL00657:Cntnap2	APN	6	46988787	missense	probably damaging	0.98
IGL00846:Cntnap2	APN	6	47193038	missense	probably benign	0.12
IGL00851:Cntnap2	APN	6	46484072	missense	probably benign
IGL00857:Cntnap2	APN	6	47049424	missense	probably benign	0.00
IGL01290:Cntnap2	APN	6	46015465	missense	probably benign	0.06
IGL01445:Cntnap2	APN	6	47193013	missense	probably benign	0.14
IGL01468:Cntnap2	APN	6	47271371	nonsense	probably null
IGL01859:Cntnap2	APN	6	46988721	missense	probably damaging	1.00
IGL02092:Cntnap2	APN	6	46234203	missense	probably damaging	1.00
IGL02239:Cntnap2	APN	6	47021654	missense	probably damaging	0.99
IGL02508:Cntnap2	APN	6	46234320	missense	probably damaging	1.00
IGL02530:Cntnap2	APN	6	47021736	missense	possibly damaging	0.48
IGL03013:Cntnap2	APN	6	47095549	missense	possibly damaging	0.66
BB004:Cntnap2	UTSW	6	47095687	missense	possibly damaging	0.93
IGL02802:Cntnap2	UTSW	6	46170245	missense	probably damaging	1.00
R0001:Cntnap2	UTSW	6	46530171	missense	probably benign	0.04
R0007:Cntnap2	UTSW	6	45992073	missense	possibly damaging	0.95
R0007:Cntnap2	UTSW	6	45992073	missense	possibly damaging	0.95
R0043:Cntnap2	UTSW	6	46483983	missense	probably benign	0.01
R0118:Cntnap2	UTSW	6	45060392	splice site	probably null
R0352:Cntnap2	UTSW	6	45992084	splice site	probably null
R0389:Cntnap2	UTSW	6	46009637	missense	probably benign	0.06
R0482:Cntnap2	UTSW	6	45715816	missense	probably benign	0.00
R0530:Cntnap2	UTSW	6	46529905	nonsense	probably null
R0611:Cntnap2	UTSW	6	47095549	missense	possibly damaging	0.66
R0630:Cntnap2	UTSW	6	46988760	missense	probably damaging	0.99
R0636:Cntnap2	UTSW	6	47296708	splice site	probably benign
R0976:Cntnap2	UTSW	6	47271230	missense	probably damaging	1.00
R1195:Cntnap2	UTSW	6	46483968	missense	probably benign
R1195:Cntnap2	UTSW	6	46483968	missense	probably benign
R1195:Cntnap2	UTSW	6	46483968	missense	probably benign
R1387:Cntnap2	UTSW	6	47107914	missense	probably benign	0.19
R1524:Cntnap2	UTSW	6	46530679	missense	probably damaging	1.00
R1609:Cntnap2	UTSW	6	46015330	missense	probably benign	0.13
R1716:Cntnap2	UTSW	6	47107892	nonsense	probably null
R1757:Cntnap2	UTSW	6	46759829	missense	probably damaging	1.00
R1809:Cntnap2	UTSW	6	46988675	missense	probably damaging	0.99
R1813:Cntnap2	UTSW	6	46530633	missense	probably damaging	1.00
R2103:Cntnap2	UTSW	6	47298588	missense	probably damaging	1.00
R2133:Cntnap2	UTSW	6	47298445	missense	probably damaging	1.00
R3037:Cntnap2	UTSW	6	46015266	missense	possibly damaging	0.57
R3899:Cntnap2	UTSW	6	45991903	missense	probably benign	0.00
R4027:Cntnap2	UTSW	6	46856128	missense	probably benign
R4030:Cntnap2	UTSW	6	46856128	missense	probably benign
R4237:Cntnap2	UTSW	6	46530390	intron	probably benign
R4445:Cntnap2	UTSW	6	46759851	missense	probably benign	0.01
R4737:Cntnap2	UTSW	6	45060317	missense	possibly damaging	0.65
R4740:Cntnap2	UTSW	6	45060317	missense	possibly damaging	0.65
R4915:Cntnap2	UTSW	6	46530035	intron	probably benign
R4918:Cntnap2	UTSW	6	46530035	intron	probably benign
R4999:Cntnap2	UTSW	6	45920834	missense	probably damaging	0.96
R5373:Cntnap2	UTSW	6	47107969	missense	probably benign	0.00
R5374:Cntnap2	UTSW	6	47107969	missense	probably benign	0.00
R5742:Cntnap2	UTSW	6	45920926	nonsense	probably null
R5748:Cntnap2	UTSW	6	45715884	missense	probably damaging	1.00
R5765:Cntnap2	UTSW	6	46529815	intron	probably benign
R6118:Cntnap2	UTSW	6	47193077	missense	possibly damaging	0.81
R6181:Cntnap2	UTSW	6	46759808	missense	probably damaging	1.00
R6189:Cntnap2	UTSW	6	47271298	missense	probably damaging	1.00
R6262:Cntnap2	UTSW	6	45060112	splice site	probably null
R6385:Cntnap2	UTSW	6	46856180	missense	probably benign	0.00
R6555:Cntnap2	UTSW	6	46759760	missense	probably damaging	1.00
R6577:Cntnap2	UTSW	6	46170272	missense	probably benign	0.25
R6610:Cntnap2	UTSW	6	46015257	missense	probably benign	0.08
R6761:Cntnap2	UTSW	6	47049373	missense	probably benign	0.03
R7125:Cntnap2	UTSW	6	46988646	missense	probably benign	0.12
R7329:Cntnap2	UTSW	6	47271271	missense	possibly damaging	0.94
R7502:Cntnap2	UTSW	6	46484029	missense	possibly damaging	0.83
R7927:Cntnap2	UTSW	6	47095687	missense	possibly damaging	0.93
R8057:Cntnap2	UTSW	6	46347145	missense	probably damaging	0.98
R8261:Cntnap2	UTSW	6	47095693	missense	probably damaging	0.98
R8356:Cntnap2	UTSW	6	47049373	missense	probably benign	0.03
R8479:Cntnap2	UTSW	6	46759773	missense	probably benign	0.14
R8503:Cntnap2	UTSW	6	45992041	missense	probably damaging	1.00
R8698:Cntnap2	UTSW	6	47049222	missense	probably damaging	1.00
R8719:Cntnap2	UTSW	6	46001227	missense	probably damaging	1.00
R8816:Cntnap2	UTSW	6	46856142	missense	possibly damaging	0.72
R8987:Cntnap2	UTSW	6	46484049	missense	probably benign	0.01
R9000:Cntnap2	UTSW	6	46484205	intron	probably benign
R9209:Cntnap2	UTSW	6	47049249	missense	probably damaging	1.00
R9253:Cntnap2	UTSW	6	46001178	missense	probably benign	0.00
R9310:Cntnap2	UTSW	6	46001347	missense	probably damaging	1.00
R9395:Cntnap2	UTSW	6	46001310	missense	probably damaging	0.98
R9462:Cntnap2	UTSW	6	46234283	missense	probably damaging	0.99
R9526:Cntnap2	UTSW	6	46015231	missense	probably damaging	1.00
R9600:Cntnap2	UTSW	6	45992075	missense	probably damaging	0.98
R9621:Cntnap2	UTSW	6	46988792	missense	probably damaging	0.98
R9738:Cntnap2	UTSW	6	46015439	frame shift	probably null
R9745:Cntnap2	UTSW	6	46234166	missense	probably benign	0.01
R9775:Cntnap2	UTSW	6	47049327	missense	probably damaging	1.00
RF022:Cntnap2	UTSW	6	47021665	missense	probably damaging	1.00
X0018:Cntnap2	UTSW	6	46009518	missense	possibly damaging	0.53
X0063:Cntnap2	UTSW	6	47021754	missense	possibly damaging	0.92
X0066:Cntnap2	UTSW	6	46234245	missense	probably benign	0.03
Z1176:Cntnap2	UTSW	6	47271148	missense	probably benign	0.00
Z1177:Cntnap2	UTSW	6	46015299	missense	possibly damaging	0.90

Predicted Primers

PCR Primer
(F):5'- TTCTCTACAGATGTTGGTGCC -3'
(R):5'- TCTGATTCTGGATAGCAACGAGG -3'

Sequencing Primer
(F):5'- AATTCTGCAGACCAGCAG -3'
(R):5'- TCAAAGGAGTCAGGTACTTTGCCC -3'

Posted On

2020-08-01