Incidental Mutation 'R0051:Coq2'
ID64282
Institutional Source Beutler Lab
Gene Symbol Coq2
Ensembl Gene ENSMUSG00000029319
Gene Namecoenzyme Q2 4-hydroxybenzoate polyprenyltransferase
Synonyms2310002F18Rik
MMRRC Submission 038345-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0051 (G1)
Quality Score171
Status Validated
Chromosome5
Chromosomal Location100654723-100675140 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 100663685 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 146 (N146S)
Ref Sequence ENSEMBL: ENSMUSP00000031262 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031262] [ENSMUST00000126981] [ENSMUST00000127811] [ENSMUST00000135801]
Predicted Effect probably benign
Transcript: ENSMUST00000031262
AA Change: N146S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000031262
Gene: ENSMUSG00000029319
AA Change: N146S

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 55 67 N/A INTRINSIC
Pfam:UbiA 89 348 2.1e-52 PFAM
low complexity region 354 365 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000126981
SMART Domains Protein: ENSMUSP00000122296
Gene: ENSMUSG00000029319

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 55 67 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127811
Predicted Effect unknown
Transcript: ENSMUST00000135146
AA Change: T104A
SMART Domains Protein: ENSMUSP00000122631
Gene: ENSMUSG00000029319
AA Change: T104A

DomainStartEndE-ValueType
low complexity region 27 39 N/A INTRINSIC
low complexity region 115 121 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135801
SMART Domains Protein: ENSMUSP00000119410
Gene: ENSMUSG00000029319

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
transmembrane domain 47 69 N/A INTRINSIC
Meta Mutation Damage Score 0.0592 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 93.8%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that functions in the final steps in the biosynthesis of CoQ (ubiquinone), a redox carrier in the mitochondrial respiratory chain and a lipid-soluble antioxidant. This enzyme, which is part of the coenzyme Q10 pathway, catalyzes the prenylation of parahydroxybenzoate with an all-trans polyprenyl group. Mutations in this gene cause coenzyme Q10 deficiency, a mitochondrial encephalomyopathy, and also COQ2 nephropathy, an inherited form of mitochondriopathy with primary renal involvement. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik A G 7: 29,579,101 noncoding transcript Het
Abr T A 11: 76,472,502 Q163L probably benign Het
AI314180 A G 4: 58,832,729 L877S probably damaging Het
Ankrd11 C A 8: 122,889,742 C2457F probably damaging Het
Anks3 G C 16: 4,947,749 T163S probably benign Het
Cacna1d G A 14: 30,111,095 P908S probably damaging Het
Ccdc146 C A 5: 21,316,904 R374L possibly damaging Het
Cdc45 G T 16: 18,794,774 A348E probably damaging Het
Cfap46 A G 7: 139,676,035 C300R probably damaging Het
Dalrd3 T C 9: 108,572,215 V120A possibly damaging Het
Dcp2 T A 18: 44,405,374 probably benign Het
Ddx39 A G 8: 83,720,622 K137R possibly damaging Het
Diaph3 A G 14: 87,037,454 probably null Het
Dmbt1 G T 7: 131,119,496 R1668L possibly damaging Het
Dnah7a T G 1: 53,521,086 probably benign Het
Dpp7 A G 2: 25,356,095 Y49H possibly damaging Het
Drd5 A G 5: 38,320,614 S317G probably benign Het
Ecsit C T 9: 22,076,288 V152I probably benign Het
Emc1 T A 4: 139,375,163 M923K possibly damaging Het
Fam102a G A 2: 32,558,053 R58Q possibly damaging Het
Fcrl6 A T 1: 172,598,753 L159Q probably benign Het
Frrs1 T C 3: 116,885,297 probably benign Het
Hspd1 A G 1: 55,082,046 probably benign Het
Impg2 T A 16: 56,258,048 S458T probably damaging Het
Klf17 T C 4: 117,760,392 Y256C probably damaging Het
Lnx2 A G 5: 147,029,353 F319L probably damaging Het
Mafg G T 11: 120,629,604 R57S probably damaging Het
Med13l T A 5: 118,742,655 W1271R probably damaging Het
Mrgprb1 A G 7: 48,447,214 S24P probably benign Het
Mtrf1l T C 10: 5,813,384 E315G probably damaging Het
Naip1 T C 13: 100,411,001 E1239G probably damaging Het
Ncaph2 T C 15: 89,369,664 S320P probably damaging Het
Nek11 A G 9: 105,218,539 probably benign Het
Nlrp2 A T 7: 5,322,334 probably benign Het
Odf3 C A 7: 140,850,221 probably benign Het
Rbm26 A C 14: 105,152,540 V216G possibly damaging Het
Rnf115 A G 3: 96,785,022 D178G probably damaging Het
Rtel1 C T 2: 181,350,656 Q424* probably null Het
Rwdd4a A G 8: 47,537,365 probably benign Het
Ryr3 T C 2: 112,869,075 D890G probably damaging Het
Scarb1 C A 5: 125,281,100 probably null Het
Serpina10 A G 12: 103,626,897 probably benign Het
Slc12a5 T A 2: 164,986,663 W508R probably damaging Het
Slc43a2 T C 11: 75,562,850 C225R probably damaging Het
Slc6a9 T C 4: 117,864,859 F440L probably damaging Het
Stac3 G A 10: 127,508,148 R305H probably damaging Het
Stk32b A G 5: 37,459,596 probably benign Het
Syna A T 5: 134,559,543 L184H probably damaging Het
Tmprss7 T C 16: 45,673,939 N401S probably damaging Het
Yeats2 T A 16: 20,193,724 Y557* probably null Het
Zcchc11 T G 4: 108,527,004 S1089R probably damaging Het
Zfp352 T C 4: 90,224,285 S221P probably damaging Het
Zfp575 A G 7: 24,586,087 V43A probably benign Het
Zfp775 A G 6: 48,620,772 T527A probably benign Het
Other mutations in Coq2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00694:Coq2 APN 5 100655314 missense probably benign 0.00
IGL02987:Coq2 APN 5 100663688 nonsense probably null
R0051:Coq2 UTSW 5 100663685 missense probably benign 0.00
R0538:Coq2 UTSW 5 100668023 missense possibly damaging 0.89
R1056:Coq2 UTSW 5 100657947 missense probably benign 0.01
R1934:Coq2 UTSW 5 100661865 missense probably damaging 1.00
R4788:Coq2 UTSW 5 100657909 missense probably damaging 0.96
R5071:Coq2 UTSW 5 100667950 missense probably damaging 1.00
R5221:Coq2 UTSW 5 100657832 missense possibly damaging 0.83
R5232:Coq2 UTSW 5 100657832 missense possibly damaging 0.83
R5233:Coq2 UTSW 5 100657832 missense possibly damaging 0.83
R6301:Coq2 UTSW 5 100661863 missense possibly damaging 0.90
R6450:Coq2 UTSW 5 100661904 utr 3 prime probably benign
R7096:Coq2 UTSW 5 100663720 utr 5 prime probably benign
R7265:Coq2 UTSW 5 100660270 missense possibly damaging 0.89
R7453:Coq2 UTSW 5 100663586 missense probably benign 0.01
R7530:Coq2 UTSW 5 100674142 missense probably benign
R7645:Coq2 UTSW 5 100660250 missense probably damaging 1.00
R7920:Coq2 UTSW 5 100663875 start gained probably benign
Predicted Primers PCR Primer
(F):5'- CCCTTCACAGGGGTCAATAAGCAG -3'
(R):5'- GGAATGGTGTCACAGCACTTAGCC -3'

Sequencing Primer
(F):5'- TGTAATAAAGAGAATCCCCCTCTATC -3'
(R):5'- ccagaggagggcagcag -3'
Posted On2013-08-06