Incidental Mutation 'BB014:Muc4'
ID642834
Institutional Source Beutler Lab
Gene Symbol Muc4
Ensembl Gene ENSMUSG00000079620
Gene Namemucin 4
Synonyms4933405I11Rik
Accession Numbers

Genbank: NM_080457; MGI: 2153525

Is this an essential gene? Probably non essential (E-score: 0.145) question?
Stock #BB014
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location32735886-32782391 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32771637 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 958 (T958A)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096106]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000096106
AA Change: T3028A

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000093813
Gene: ENSMUSG00000079620
AA Change: T3028A

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
low complexity region 37 65 N/A INTRINSIC
low complexity region 86 111 N/A INTRINSIC
internal_repeat_2 119 903 6.07e-127 PROSPERO
internal_repeat_1 164 987 3.47e-144 PROSPERO
internal_repeat_2 979 1875 6.07e-127 PROSPERO
internal_repeat_1 1193 2087 3.47e-144 PROSPERO
low complexity region 2090 2106 N/A INTRINSIC
low complexity region 2111 2119 N/A INTRINSIC
low complexity region 2186 2195 N/A INTRINSIC
low complexity region 2230 2249 N/A INTRINSIC
low complexity region 2324 2332 N/A INTRINSIC
low complexity region 2344 2367 N/A INTRINSIC
NIDO 2458 2615 8.33e-67 SMART
AMOP 2614 2726 1.29e-47 SMART
VWD 2729 2910 4.23e-26 SMART
EGF_like 3134 3166 3.23e1 SMART
EGF_like 3176 3212 3.5e1 SMART
low complexity region 3237 3251 N/A INTRINSIC
EGF 3384 3421 1.4e0 SMART
transmembrane domain 3430 3452 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000119154
Gene: ENSMUSG00000079620
AA Change: T958A

DomainStartEndE-ValueType
low complexity region 21 37 N/A INTRINSIC
low complexity region 42 50 N/A INTRINSIC
low complexity region 117 126 N/A INTRINSIC
low complexity region 161 180 N/A INTRINSIC
low complexity region 255 263 N/A INTRINSIC
low complexity region 275 298 N/A INTRINSIC
NIDO 389 546 8.33e-67 SMART
AMOP 545 657 1.29e-47 SMART
VWD 660 841 4.23e-26 SMART
EGF_like 1065 1097 3.23e1 SMART
EGF_like 1107 1143 3.5e1 SMART
low complexity region 1168 1182 N/A INTRINSIC
EGF 1315 1352 1.4e0 SMART
transmembrane domain 1361 1383 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: The major constituents of mucus, the viscous secretion that covers epithelial surfaces such as those in the trachea, colon, and cervix, are highly glycosylated proteins called mucins. These glycoproteins play important roles in the protection of the epithelial cells and have been implicated in epithelial renewal and differentiation. This gene encodes an integral membrane glycoprotein found on the cell surface. A large 5' exon encodes at least 15 tandem repeats of 124-126 amino acids. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit resistance to DSS-treated colitis and colitis-associated colorectal cancer. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110051M20Rik T A 2: 91,421,905 D37V probably damaging Het
4921539E11Rik A G 4: 103,266,342 M111T probably benign Het
Adprhl1 C T 8: 13,248,682 V83I probably damaging Het
Agrn C T 4: 156,172,809 G1188D probably damaging Het
Amz2 A G 11: 109,429,058 K90R probably damaging Het
Arhgef4 G T 1: 34,807,253 Q227H probably damaging Het
B4galt3 T A 1: 171,271,772 C10* probably null Het
Banf2 T A 2: 144,073,798 M53K probably benign Het
BC034090 A T 1: 155,241,625 L249* probably null Het
Cftr A G 6: 18,267,971 D673G possibly damaging Het
Cntnap2 G T 6: 47,095,687 C1063F possibly damaging Het
Dnah3 A G 7: 119,951,271 I296T probably damaging Het
Dpy19l2 A G 9: 24,695,901 V88A probably benign Het
Fbln5 T C 12: 101,818,388 probably benign Het
Fbn1 T C 2: 125,383,736 D532G possibly damaging Het
Fnta G A 8: 26,004,426 R258* probably null Het
Gch1 G A 14: 47,155,923 H201Y probably damaging Het
Gm13023 T A 4: 143,792,966 I99N probably benign Het
Grik2 A T 10: 49,240,794 S624T probably damaging Het
Grm5 T A 7: 88,036,174 S500T probably benign Het
Hmcn1 T A 1: 150,609,775 I4359F probably damaging Het
Hrc T A 7: 45,336,053 H209Q possibly damaging Het
Hsd17b14 T C 7: 45,565,971 M164T probably damaging Het
Hydin T C 8: 110,580,844 F3952L possibly damaging Het
Kti12 A C 4: 108,848,246 E119A probably benign Het
Kti12 G T 4: 108,848,247 E119D probably benign Het
Lig4 A T 8: 9,973,629 H50Q possibly damaging Het
Lrp6 G T 6: 134,520,550 R165S probably damaging Het
Myo19 A G 11: 84,900,220 E419G probably damaging Het
Ndufa5 A G 6: 24,527,292 V16A possibly damaging Het
Olfr714 T C 7: 107,074,289 F154L probably benign Het
Phf24 A C 4: 42,934,774 T137P probably damaging Het
Pkp4 A T 2: 59,311,754 N467I probably damaging Het
Rbm12b2 C T 4: 12,095,417 R759C possibly damaging Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Rnf34 T A 5: 122,850,225 probably benign Het
Rsf1 GGCGGCGGC GGCGGCGGCAGCGGCGGC 7: 97,579,924 probably benign Het
Scaf8 T A 17: 3,159,220 S73T unknown Het
Scn4a T A 11: 106,342,383 E454D probably damaging Het
Serpina1e A G 12: 103,951,191 V73A probably benign Het
Sh3rf2 A G 18: 42,111,422 T350A probably benign Het
Slc35a1 A G 4: 34,669,021 V264A probably damaging Het
Slf2 A G 19: 44,935,301 K185E probably damaging Het
Spsb2 T C 6: 124,809,373 F23S probably benign Het
Ssx2ip T G 3: 146,432,610 L404R probably damaging Het
Strn4 T A 7: 16,826,631 L236Q probably null Het
Tcp10b A G 17: 13,069,692 T202A probably benign Het
Tdp1 G T 12: 99,912,296 V448L probably damaging Het
Tecrl T C 5: 83,354,819 E61G probably damaging Het
Tepp T A 8: 95,313,158 S68T probably benign Het
Trim50 T C 5: 135,353,611 F106L probably benign Het
Usp5 G T 6: 124,824,229 F224L probably benign Het
Vmn2r45 C A 7: 8,483,514 M258I probably benign Het
Zfp574 T A 7: 25,080,147 V198E probably benign Het
Zmym4 A G 4: 126,905,377 I722T probably benign Het
Other mutations in Muc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Muc4 APN 16 32754086 missense probably benign 0.35
IGL00088:Muc4 APN 16 32754086 missense probably benign 0.35
IGL00089:Muc4 APN 16 32754086 missense probably benign 0.35
IGL00090:Muc4 APN 16 32754086 missense probably benign 0.35
IGL00091:Muc4 APN 16 32754086 missense probably benign 0.35
IGL00092:Muc4 APN 16 32754086 missense probably benign 0.35
IGL00163:Muc4 APN 16 32754090 missense probably benign 0.20
IGL00324:Muc4 APN 16 32778812 missense probably benign 0.03
IGL00331:Muc4 APN 16 32753185 missense probably benign 0.01
IGL00539:Muc4 APN 16 32750910 missense possibly damaging 0.53
IGL00590:Muc4 APN 16 32754347 missense probably benign 0.10
IGL00990:Muc4 APN 16 32753955 missense possibly damaging 0.86
IGL00990:Muc4 APN 16 32755805 unclassified probably benign
IGL00990:Muc4 APN 16 32753823 missense probably benign 0.01
IGL00990:Muc4 APN 16 32753848 missense probably benign 0.01
IGL00990:Muc4 APN 16 32753849 missense probably benign 0.01
IGL00990:Muc4 APN 16 32753863 missense probably benign 0.01
IGL00990:Muc4 APN 16 32753886 missense probably benign 0.01
IGL00990:Muc4 APN 16 32752569 missense probably benign 0.01
IGL00990:Muc4 APN 16 32754071 missense probably benign 0.01
IGL01091:Muc4 APN 16 32753927 missense probably benign 0.04
IGL01124:Muc4 APN 16 32768730 missense possibly damaging 0.65
IGL01131:Muc4 APN 16 32753901 missense possibly damaging 0.72
IGL01536:Muc4 APN 16 32763966 missense possibly damaging 0.93
IGL01603:Muc4 APN 16 32750655 missense probably benign 0.23
IGL01618:Muc4 APN 16 32756627 missense unknown
IGL01625:Muc4 APN 16 32755544 unclassified probably benign
IGL01626:Muc4 APN 16 32736402 missense possibly damaging 0.48
IGL01653:Muc4 APN 16 32761348 splice site probably null
IGL01682:Muc4 APN 16 32754086 missense probably benign 0.35
IGL01870:Muc4 APN 16 32753196 missense probably benign 0.01
IGL01966:Muc4 APN 16 32751426 missense possibly damaging 0.84
IGL01973:Muc4 APN 16 32754265 missense probably benign 0.01
IGL02089:Muc4 APN 16 32751313 missense possibly damaging 0.83
IGL02152:Muc4 APN 16 32777649 splice site probably benign
IGL02210:Muc4 APN 16 32752254 missense probably benign 0.00
IGL02278:Muc4 APN 16 32754529 missense probably benign 0.01
IGL02280:Muc4 APN 16 32754529 missense probably benign 0.01
IGL02316:Muc4 APN 16 32750850 missense possibly damaging 0.73
IGL02351:Muc4 APN 16 32750986 missense possibly damaging 0.86
IGL02358:Muc4 APN 16 32750986 missense possibly damaging 0.86
IGL02391:Muc4 APN 16 32752076 missense probably benign 0.41
IGL02449:Muc4 APN 16 32756129 unclassified probably benign
IGL02607:Muc4 APN 16 32775819 missense possibly damaging 0.73
IGL02888:Muc4 APN 16 32755282 unclassified probably benign
IGL02893:Muc4 APN 16 32751648 missense possibly damaging 0.68
IGL02902:Muc4 APN 16 32750394 missense possibly damaging 0.50
IGL03007:Muc4 APN 16 32752048 missense possibly damaging 0.84
IGL03161:Muc4 APN 16 32751948 missense possibly damaging 0.84
IGL03304:Muc4 APN 16 32751439 nonsense probably null
IGL03335:Muc4 APN 16 32753021 missense probably benign 0.01
IGL03411:Muc4 APN 16 32754318 missense probably benign 0.01
multisplendored UTSW 16 32751051 missense possibly damaging 0.53
protean UTSW 16 32754689 missense probably benign 0.00
R0864_muc4_269 UTSW 16 32752002 missense probably benign 0.01
3-1:Muc4 UTSW 16 32760251 splice site probably benign
3-1:Muc4 UTSW 16 32770394 missense possibly damaging 0.86
BB004:Muc4 UTSW 16 32771637 missense
IGL02835:Muc4 UTSW 16 32763945 missense probably benign 0.32
P0035:Muc4 UTSW 16 32760248 splice site probably benign
PIT4131001:Muc4 UTSW 16 32755676 unclassified probably benign
PIT4131001:Muc4 UTSW 16 32755684 unclassified probably benign
PIT4131001:Muc4 UTSW 16 32755699 unclassified probably benign
PIT4142001:Muc4 UTSW 16 32754529 missense probably benign 0.01
PIT4142001:Muc4 UTSW 16 32755676 unclassified probably benign
PIT4142001:Muc4 UTSW 16 32755684 unclassified probably benign
PIT4366001:Muc4 UTSW 16 32754796 missense unknown
PIT4531001:Muc4 UTSW 16 32756017 missense unknown
R0119:Muc4 UTSW 16 32750195 critical splice acceptor site probably benign
R0133:Muc4 UTSW 16 32771604 missense possibly damaging 0.91
R0136:Muc4 UTSW 16 32750195 critical splice acceptor site probably benign
R0243:Muc4 UTSW 16 32765746 missense possibly damaging 0.53
R0277:Muc4 UTSW 16 32755690 unclassified probably benign
R0299:Muc4 UTSW 16 32750195 critical splice acceptor site probably benign
R0380:Muc4 UTSW 16 32752905 missense probably benign 0.00
R0462:Muc4 UTSW 16 32762536 missense possibly damaging 0.93
R0507:Muc4 UTSW 16 32751069 missense probably benign 0.01
R0508:Muc4 UTSW 16 32751313 missense possibly damaging 0.83
R0543:Muc4 UTSW 16 32756746 missense unknown
R0578:Muc4 UTSW 16 32755690 unclassified probably benign
R0617:Muc4 UTSW 16 32752107 missense possibly damaging 0.83
R0656:Muc4 UTSW 16 32751670 missense possibly damaging 0.91
R0726:Muc4 UTSW 16 32769827 missense probably damaging 0.99
R0727:Muc4 UTSW 16 32769847 missense probably benign 0.01
R0776:Muc4 UTSW 16 32752220 missense probably benign 0.04
R0854:Muc4 UTSW 16 32778955 missense possibly damaging 0.53
R0862:Muc4 UTSW 16 32752002 missense probably benign 0.01
R0864:Muc4 UTSW 16 32752002 missense probably benign 0.01
R0926:Muc4 UTSW 16 32756196 unclassified probably benign
R0990:Muc4 UTSW 16 32752722 missense probably benign 0.00
R1127:Muc4 UTSW 16 32750525 missense possibly damaging 0.92
R1203:Muc4 UTSW 16 32754529 missense probably benign 0.01
R1433:Muc4 UTSW 16 32753020 missense probably benign 0.00
R1466:Muc4 UTSW 16 32753595 missense probably benign 0.04
R1466:Muc4 UTSW 16 32753595 missense probably benign 0.04
R1506:Muc4 UTSW 16 32752233 missense possibly damaging 0.59
R1518:Muc4 UTSW 16 32750349 missense possibly damaging 0.84
R1544:Muc4 UTSW 16 32753919 missense probably benign 0.10
R1584:Muc4 UTSW 16 32753595 missense probably benign 0.04
R1593:Muc4 UTSW 16 32754686 missense probably benign 0.00
R1601:Muc4 UTSW 16 32755501 unclassified probably benign
R1611:Muc4 UTSW 16 32750986 missense possibly damaging 0.86
R1673:Muc4 UTSW 16 32756902 missense probably benign 0.11
R1717:Muc4 UTSW 16 32753405 missense possibly damaging 0.53
R1822:Muc4 UTSW 16 32753919 missense probably benign 0.10
R1824:Muc4 UTSW 16 32755933 unclassified probably benign
R1839:Muc4 UTSW 16 32753919 missense probably benign 0.10
R1846:Muc4 UTSW 16 32752369 missense probably benign 0.01
R1864:Muc4 UTSW 16 32756251 unclassified probably benign
R1868:Muc4 UTSW 16 32756341 missense unknown
R1928:Muc4 UTSW 16 32750532 missense probably damaging 0.99
R1942:Muc4 UTSW 16 32750642 missense probably damaging 0.99
R2017:Muc4 UTSW 16 32751303 missense possibly damaging 0.92
R2023:Muc4 UTSW 16 32752254 missense probably benign 0.00
R2081:Muc4 UTSW 16 32752220 missense probably benign 0.04
R2088:Muc4 UTSW 16 32756409 missense unknown
R2121:Muc4 UTSW 16 32760238 missense unknown
R2139:Muc4 UTSW 16 32761225 missense unknown
R2158:Muc4 UTSW 16 32754563 missense probably benign 0.10
R2165:Muc4 UTSW 16 32750476 missense probably damaging 0.96
R2210:Muc4 UTSW 16 32755176 frame shift probably null
R2225:Muc4 UTSW 16 32755891 unclassified probably benign
R2225:Muc4 UTSW 16 32766942 missense possibly damaging 0.73
R2269:Muc4 UTSW 16 32754529 missense probably benign 0.01
R2679:Muc4 UTSW 16 32757472 missense unknown
R3703:Muc4 UTSW 16 32753919 missense probably benign 0.10
R3816:Muc4 UTSW 16 32754529 missense probably benign 0.01
R3909:Muc4 UTSW 16 32753919 missense probably benign 0.10
R4014:Muc4 UTSW 16 32755273 unclassified probably benign
R4065:Muc4 UTSW 16 32751051 missense possibly damaging 0.53
R4066:Muc4 UTSW 16 32751051 missense possibly damaging 0.53
R4067:Muc4 UTSW 16 32751051 missense possibly damaging 0.53
R4245:Muc4 UTSW 16 32753802 missense probably benign 0.04
R4249:Muc4 UTSW 16 32755826 unclassified probably benign
R4344:Muc4 UTSW 16 32770292 missense possibly damaging 0.53
R4388:Muc4 UTSW 16 32753802 missense probably benign 0.04
R4393:Muc4 UTSW 16 32754529 missense probably benign 0.01
R4482:Muc4 UTSW 16 32756701 missense unknown
R4523:Muc4 UTSW 16 32736336 utr 5 prime probably benign
R4527:Muc4 UTSW 16 32755843 unclassified probably benign
R4572:Muc4 UTSW 16 32753802 missense probably benign 0.04
R4587:Muc4 UTSW 16 32753919 missense probably benign 0.10
R4614:Muc4 UTSW 16 32757058 missense probably benign 0.03
R4635:Muc4 UTSW 16 32753802 missense probably benign 0.04
R4661:Muc4 UTSW 16 32769277 missense possibly damaging 0.71
R4701:Muc4 UTSW 16 32755846 unclassified probably benign
R4730:Muc4 UTSW 16 32751214 missense possibly damaging 0.86
R4740:Muc4 UTSW 16 32775903 missense possibly damaging 0.91
R4762:Muc4 UTSW 16 32753625 unclassified probably benign
R4818:Muc4 UTSW 16 32753919 missense probably benign 0.10
R4821:Muc4 UTSW 16 32753802 missense probably benign 0.04
R4825:Muc4 UTSW 16 32751747 missense probably benign 0.41
R4830:Muc4 UTSW 16 32753919 missense probably benign 0.10
R4860:Muc4 UTSW 16 32754616 missense probably benign 0.35
R4860:Muc4 UTSW 16 32754625 missense probably benign 0.18
R4869:Muc4 UTSW 16 32754836 unclassified probably benign
R4934:Muc4 UTSW 16 32756098 unclassified probably benign
R4959:Muc4 UTSW 16 32754319 missense possibly damaging 0.73
R4969:Muc4 UTSW 16 32754572 missense probably benign 0.01
R4995:Muc4 UTSW 16 32754214 missense probably benign 0.01
R4995:Muc4 UTSW 16 32754041 missense probably benign 0.01
R4999:Muc4 UTSW 16 32756296 unclassified probably benign
R5073:Muc4 UTSW 16 32754529 missense probably benign 0.01
R5075:Muc4 UTSW 16 32754794 unclassified probably benign
R5152:Muc4 UTSW 16 32757058 nonsense probably null
R5161:Muc4 UTSW 16 32762521 missense probably damaging 0.98
R5174:Muc4 UTSW 16 32751738 missense possibly damaging 0.84
R5268:Muc4 UTSW 16 32751666 missense possibly damaging 0.83
R5447:Muc4 UTSW 16 32753919 missense probably benign 0.10
R5474:Muc4 UTSW 16 32761261 missense unknown
R5567:Muc4 UTSW 16 32777692 missense possibly damaging 0.72
R5570:Muc4 UTSW 16 32777692 missense possibly damaging 0.72
R5618:Muc4 UTSW 16 32754253 missense probably benign 0.01
R5665:Muc4 UTSW 16 32750782 missense probably benign 0.33
R5667:Muc4 UTSW 16 32753720 missense probably benign 0.01
R5671:Muc4 UTSW 16 32753720 missense probably benign 0.01
R5693:Muc4 UTSW 16 32776807 missense possibly damaging 0.53
R5703:Muc4 UTSW 16 32736241 nonsense probably null
R5708:Muc4 UTSW 16 32754769 unclassified probably benign
R5715:Muc4 UTSW 16 32751916 missense possibly damaging 0.92
R5849:Muc4 UTSW 16 32774839 missense possibly damaging 0.53
R5873:Muc4 UTSW 16 32751295 missense possibly damaging 0.61
R5930:Muc4 UTSW 16 32751705 missense probably benign 0.41
R5933:Muc4 UTSW 16 32753052 missense probably benign 0.01
R5966:Muc4 UTSW 16 32756278 unclassified probably benign
R6062:Muc4 UTSW 16 32759308 missense unknown
R6067:Muc4 UTSW 16 32755247 unclassified probably benign
R6067:Muc4 UTSW 16 32754529 missense probably benign 0.01
R6078:Muc4 UTSW 16 32755247 unclassified probably benign
R6079:Muc4 UTSW 16 32755247 unclassified probably benign
R6112:Muc4 UTSW 16 32775783 missense possibly damaging 0.86
R6120:Muc4 UTSW 16 32756795 missense unknown
R6144:Muc4 UTSW 16 32766924 missense possibly damaging 0.53
R6148:Muc4 UTSW 16 32753802 missense probably benign 0.04
R6173:Muc4 UTSW 16 32736140 start gained probably benign
R6268:Muc4 UTSW 16 32768767 missense probably damaging 0.99
R6299:Muc4 UTSW 16 32752035 missense possibly damaging 0.48
R6307:Muc4 UTSW 16 32753946 missense possibly damaging 0.56
R6354:Muc4 UTSW 16 32754358 missense probably benign 0.19
R6361:Muc4 UTSW 16 32767351 missense probably benign 0.32
R6375:Muc4 UTSW 16 32736243 utr 5 prime probably benign
R6378:Muc4 UTSW 16 32778946 missense probably benign 0.33
R6418:Muc4 UTSW 16 32751789 missense possibly damaging 0.68
R6458:Muc4 UTSW 16 32759320 critical splice donor site probably null
R6527:Muc4 UTSW 16 32753433 missense probably benign 0.01
R6616:Muc4 UTSW 16 32782008 missense possibly damaging 0.93
R6636:Muc4 UTSW 16 32753964 missense probably benign 0.01
R6637:Muc4 UTSW 16 32753964 missense probably benign 0.01
R6915:Muc4 UTSW 16 32766938 missense probably benign 0.18
R6947:Muc4 UTSW 16 32775803 missense possibly damaging 0.91
R6976:Muc4 UTSW 16 32762518 missense possibly damaging 0.92
R6985:Muc4 UTSW 16 32751999 missense probably benign 0.00
R7020:Muc4 UTSW 16 32751810 nonsense probably null
R7033:Muc4 UTSW 16 32756324 unclassified probably benign
R7098:Muc4 UTSW 16 32757091 missense
R7123:Muc4 UTSW 16 32750691 missense possibly damaging 0.83
R7173:Muc4 UTSW 16 32762488 missense probably damaging 0.97
R7178:Muc4 UTSW 16 32752788 missense unknown
R7294:Muc4 UTSW 16 32756461 missense possibly damaging 0.53
R7318:Muc4 UTSW 16 32755336 missense unknown
R7361:Muc4 UTSW 16 32754670 missense probably benign 0.18
R7380:Muc4 UTSW 16 32755366 missense unknown
R7381:Muc4 UTSW 16 32780915 missense
R7411:Muc4 UTSW 16 32751322 missense probably benign 0.12
R7422:Muc4 UTSW 16 32754689 missense probably benign 0.00
R7482:Muc4 UTSW 16 32766950 missense
R7539:Muc4 UTSW 16 32756396 missense
R7544:Muc4 UTSW 16 32736198 start codon destroyed probably null
R7574:Muc4 UTSW 16 32753411 missense probably benign 0.18
R7576:Muc4 UTSW 16 32754500 missense probably benign 0.10
R7585:Muc4 UTSW 16 32765702 missense
R7596:Muc4 UTSW 16 32753930 missense probably benign 0.01
R7597:Muc4 UTSW 16 32753930 missense probably benign 0.01
R7602:Muc4 UTSW 16 32753930 missense probably benign 0.01
R7616:Muc4 UTSW 16 32752361 nonsense probably null
R7639:Muc4 UTSW 16 32753930 missense probably benign 0.01
R7640:Muc4 UTSW 16 32760105 missense
R7651:Muc4 UTSW 16 32756575 missense
R7688:Muc4 UTSW 16 32751460 missense possibly damaging 0.68
R7689:Muc4 UTSW 16 32753011 missense probably benign 0.10
R7752:Muc4 UTSW 16 32768734 missense
R7763:Muc4 UTSW 16 32753311 missense probably benign 0.10
R7768:Muc4 UTSW 16 32756194 missense unknown
R7787:Muc4 UTSW 16 32753930 missense probably benign 0.01
R7789:Muc4 UTSW 16 32753930 missense probably benign 0.01
R7838:Muc4 UTSW 16 32752558 nonsense probably null
R7871:Muc4 UTSW 16 32754935 missense unknown
R7921:Muc4 UTSW 16 32751321 missense possibly damaging 0.68
R7927:Muc4 UTSW 16 32771637 missense
R7930:Muc4 UTSW 16 32754078 unclassified probably benign
R8000:Muc4 UTSW 16 32753930 missense probably benign 0.01
R8062:Muc4 UTSW 16 32756749 missense
R8096:Muc4 UTSW 16 32755390 missense unknown
R8115:Muc4 UTSW 16 32755304 missense unknown
R8162:Muc4 UTSW 16 32750379 missense unknown
R8220:Muc4 UTSW 16 32755327 missense unknown
R8260:Muc4 UTSW 16 32754076 unclassified probably benign
R8290:Muc4 UTSW 16 32754316 missense probably benign 0.01
R8299:Muc4 UTSW 16 32755897 missense unknown
R8313:Muc4 UTSW 16 32753423 missense probably benign 0.04
R8356:Muc4 UTSW 16 32754076 unclassified probably benign
R8463:Muc4 UTSW 16 32752401 missense probably benign 0.00
R8479:Muc4 UTSW 16 32753508 missense possibly damaging 0.59
R8480:Muc4 UTSW 16 32752993 missense probably benign 0.20
R8510:Muc4 UTSW 16 32754076 unclassified probably benign
R8515:Muc4 UTSW 16 32755255 missense unknown
R8559:Muc4 UTSW 16 32754715 missense unknown
R8685:Muc4 UTSW 16 32753930 missense probably benign 0.01
R8687:Muc4 UTSW 16 32753930 missense probably benign 0.01
R8728:Muc4 UTSW 16 32754952 missense unknown
R8754:Muc4 UTSW 16 32781986 missense
R8845:Muc4 UTSW 16 32756515 missense possibly damaging 0.86
R8852:Muc4 UTSW 16 32750643 missense possibly damaging 0.66
R8863:Muc4 UTSW 16 32751462 missense possibly damaging 0.84
R8896:Muc4 UTSW 16 32754673 missense probably benign 0.01
R8990:Muc4 UTSW 16 32752209 missense probably benign 0.01
R9018:Muc4 UTSW 16 32762536 missense
R9034:Muc4 UTSW 16 32754076 unclassified probably benign
R9064:Muc4 UTSW 16 32754397 missense possibly damaging 0.53
R9068:Muc4 UTSW 16 32754076 unclassified probably benign
R9086:Muc4 UTSW 16 32757468 missense
R9151:Muc4 UTSW 16 32752617 missense not run
RF014:Muc4 UTSW 16 32751858 missense probably damaging 0.98
U15987:Muc4 UTSW 16 32754529 missense probably benign 0.01
U15987:Muc4 UTSW 16 32755247 unclassified probably benign
V5622:Muc4 UTSW 16 32751825 missense probably benign 0.00
X0018:Muc4 UTSW 16 32755481 unclassified probably benign
X0028:Muc4 UTSW 16 32759319 critical splice donor site probably null
Z1088:Muc4 UTSW 16 32756076 unclassified probably benign
Z1176:Muc4 UTSW 16 32768730 missense possibly damaging 0.65
Z1177:Muc4 UTSW 16 32767393 nonsense probably null
Z1177:Muc4 UTSW 16 32767394 missense
Z1177:Muc4 UTSW 16 32774862 missense
Predicted Primers PCR Primer
(F):5'- GAAGACTGAGTTCTGCTCCCAG -3'
(R):5'- CGAACAAAATGTCTGTTGGTCTTG -3'

Sequencing Primer
(F):5'- TCTGCTCCCAGAGGCCG -3'
(R):5'- CCTATTGCCAGCCAAAGAT -3'
Posted On2020-08-01