Incidental Mutation 'BB014:Slf2'
ID 642839
Institutional Source Beutler Lab
Gene Symbol Slf2
Ensembl Gene ENSMUSG00000036097
Gene Name SMC5-SMC6 complex localization factor 2
Synonyms 6030443O07Rik, Fam178a
Accession Numbers
Essential gene? Probably essential (E-score: 0.910) question?
Stock # BB014
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 44919590-44971738 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 44923740 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 185 (K185E)
Ref Sequence ENSEMBL: ENSMUSP00000093758 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096053]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000096053
AA Change: K185E

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000093758
Gene: ENSMUSG00000036097
AA Change: K185E

DomainStartEndE-ValueType
low complexity region 7 24 N/A INTRINSIC
low complexity region 91 103 N/A INTRINSIC
low complexity region 211 226 N/A INTRINSIC
coiled coil region 239 266 N/A INTRINSIC
low complexity region 495 514 N/A INTRINSIC
low complexity region 528 539 N/A INTRINSIC
low complexity region 549 568 N/A INTRINSIC
low complexity region 572 582 N/A INTRINSIC
low complexity region 601 616 N/A INTRINSIC
Pfam:FAM178 647 1021 3.9e-146 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik A G 4: 103,123,539 (GRCm39) M111T probably benign Het
Adprhl1 C T 8: 13,298,682 (GRCm39) V83I probably damaging Het
Agrn C T 4: 156,257,266 (GRCm39) G1188D probably damaging Het
Amz2 A G 11: 109,319,884 (GRCm39) K90R probably damaging Het
Arhgef4 G T 1: 34,846,334 (GRCm39) Q227H probably damaging Het
B4galt3 T A 1: 171,099,342 (GRCm39) C10* probably null Het
Banf2 T A 2: 143,915,718 (GRCm39) M53K probably benign Het
BC034090 A T 1: 155,117,371 (GRCm39) L249* probably null Het
Cftr A G 6: 18,267,970 (GRCm39) D673G possibly damaging Het
Cntnap2 G T 6: 47,072,621 (GRCm39) C1063F possibly damaging Het
Cstpp1 T A 2: 91,252,250 (GRCm39) D37V probably damaging Het
Dnah3 A G 7: 119,550,494 (GRCm39) I296T probably damaging Het
Dpy19l2 A G 9: 24,607,197 (GRCm39) V88A probably benign Het
Fbln5 T C 12: 101,784,647 (GRCm39) probably benign Het
Fbn1 T C 2: 125,225,656 (GRCm39) D532G possibly damaging Het
Fnta G A 8: 26,494,454 (GRCm39) R258* probably null Het
Gch1 G A 14: 47,393,380 (GRCm39) H201Y probably damaging Het
Grik2 A T 10: 49,116,890 (GRCm39) S624T probably damaging Het
Grm5 T A 7: 87,685,382 (GRCm39) S500T probably benign Het
Hmcn1 T A 1: 150,485,526 (GRCm39) I4359F probably damaging Het
Hrc T A 7: 44,985,477 (GRCm39) H209Q possibly damaging Het
Hsd17b14 T C 7: 45,215,395 (GRCm39) M164T probably damaging Het
Hydin T C 8: 111,307,476 (GRCm39) F3952L possibly damaging Het
Kti12 A C 4: 108,705,443 (GRCm39) E119A probably benign Het
Kti12 G T 4: 108,705,444 (GRCm39) E119D probably benign Het
Lig4 A T 8: 10,023,629 (GRCm39) H50Q possibly damaging Het
Lrp6 G T 6: 134,497,513 (GRCm39) R165S probably damaging Het
Muc4 A G 16: 32,592,011 (GRCm39) T958A Het
Myo19 A G 11: 84,791,046 (GRCm39) E419G probably damaging Het
Ndufa5 A G 6: 24,527,291 (GRCm39) V16A possibly damaging Het
Or10a2 T C 7: 106,673,496 (GRCm39) F154L probably benign Het
Phf24 A C 4: 42,934,774 (GRCm39) T137P probably damaging Het
Pkp4 A T 2: 59,142,098 (GRCm39) N467I probably damaging Het
Pramel25 T A 4: 143,519,536 (GRCm39) I99N probably benign Het
Rbm12b2 C T 4: 12,095,417 (GRCm39) R759C possibly damaging Het
Rftn1 G T 17: 50,354,408 (GRCm39) A318D probably damaging Het
Rnf34 T A 5: 122,988,288 (GRCm39) probably benign Het
Rsf1 GGCGGCGGC GGCGGCGGCAGCGGCGGC 7: 97,229,131 (GRCm39) probably benign Het
Scaf8 T A 17: 3,209,495 (GRCm39) S73T unknown Het
Scn4a T A 11: 106,233,209 (GRCm39) E454D probably damaging Het
Serpina1e A G 12: 103,917,450 (GRCm39) V73A probably benign Het
Sh3rf2 A G 18: 42,244,487 (GRCm39) T350A probably benign Het
Slc35a1 A G 4: 34,669,021 (GRCm39) V264A probably damaging Het
Spmip8 T A 8: 96,039,786 (GRCm39) S68T probably benign Het
Spsb2 T C 6: 124,786,336 (GRCm39) F23S probably benign Het
Ssx2ip T G 3: 146,138,365 (GRCm39) L404R probably damaging Het
Strn4 T A 7: 16,560,556 (GRCm39) L236Q probably null Het
Tcp10b A G 17: 13,288,579 (GRCm39) T202A probably benign Het
Tdp1 G T 12: 99,878,555 (GRCm39) V448L probably damaging Het
Tecrl T C 5: 83,502,666 (GRCm39) E61G probably damaging Het
Trim50 T C 5: 135,382,465 (GRCm39) F106L probably benign Het
Usp5 G T 6: 124,801,192 (GRCm39) F224L probably benign Het
Vmn2r45 C A 7: 8,486,513 (GRCm39) M258I probably benign Het
Zfp574 T A 7: 24,779,572 (GRCm39) V198E probably benign Het
Zmym4 A G 4: 126,799,170 (GRCm39) I722T probably benign Het
Other mutations in Slf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01734:Slf2 APN 19 44,961,706 (GRCm39) critical splice donor site probably null
IGL01904:Slf2 APN 19 44,937,580 (GRCm39) critical splice donor site probably null
IGL02429:Slf2 APN 19 44,930,167 (GRCm39) missense probably benign
IGL02899:Slf2 APN 19 44,930,459 (GRCm39) missense probably benign 0.26
Evidentiary UTSW 19 44,926,863 (GRCm39) splice site probably null
BB004:Slf2 UTSW 19 44,923,740 (GRCm39) missense probably damaging 0.97
R0060:Slf2 UTSW 19 44,936,443 (GRCm39) missense probably damaging 1.00
R0731:Slf2 UTSW 19 44,964,165 (GRCm39) splice site probably benign
R1158:Slf2 UTSW 19 44,919,855 (GRCm39) missense probably damaging 0.99
R1590:Slf2 UTSW 19 44,930,512 (GRCm39) nonsense probably null
R1608:Slf2 UTSW 19 44,937,440 (GRCm39) missense probably benign 0.08
R1823:Slf2 UTSW 19 44,923,687 (GRCm39) missense possibly damaging 0.86
R2511:Slf2 UTSW 19 44,930,045 (GRCm39) missense possibly damaging 0.86
R3040:Slf2 UTSW 19 44,969,008 (GRCm39) missense probably damaging 0.99
R3236:Slf2 UTSW 19 44,930,773 (GRCm39) missense probably benign 0.33
R3237:Slf2 UTSW 19 44,930,773 (GRCm39) missense probably benign 0.33
R3552:Slf2 UTSW 19 44,923,390 (GRCm39) nonsense probably null
R3754:Slf2 UTSW 19 44,961,676 (GRCm39) missense probably benign
R4683:Slf2 UTSW 19 44,923,920 (GRCm39) missense probably benign 0.22
R4757:Slf2 UTSW 19 44,923,497 (GRCm39) missense probably benign
R4782:Slf2 UTSW 19 44,923,364 (GRCm39) splice site probably null
R4914:Slf2 UTSW 19 44,960,100 (GRCm39) missense probably damaging 0.96
R4915:Slf2 UTSW 19 44,960,100 (GRCm39) missense probably damaging 0.96
R4916:Slf2 UTSW 19 44,960,100 (GRCm39) missense probably damaging 0.96
R4917:Slf2 UTSW 19 44,960,100 (GRCm39) missense probably damaging 0.96
R4918:Slf2 UTSW 19 44,960,100 (GRCm39) missense probably damaging 0.96
R5069:Slf2 UTSW 19 44,923,692 (GRCm39) missense possibly damaging 0.94
R5092:Slf2 UTSW 19 44,940,523 (GRCm39) missense probably benign 0.14
R5215:Slf2 UTSW 19 44,936,476 (GRCm39) missense probably damaging 0.99
R5276:Slf2 UTSW 19 44,923,600 (GRCm39) missense possibly damaging 0.84
R5656:Slf2 UTSW 19 44,961,674 (GRCm39) missense probably benign 0.13
R6132:Slf2 UTSW 19 44,949,300 (GRCm39) missense possibly damaging 0.60
R6358:Slf2 UTSW 19 44,923,864 (GRCm39) missense probably benign 0.34
R6481:Slf2 UTSW 19 44,961,603 (GRCm39) missense probably benign 0.01
R6809:Slf2 UTSW 19 44,931,907 (GRCm39) missense probably damaging 0.98
R7263:Slf2 UTSW 19 44,926,863 (GRCm39) splice site probably null
R7912:Slf2 UTSW 19 44,930,682 (GRCm39) missense probably damaging 0.96
R7914:Slf2 UTSW 19 44,947,499 (GRCm39) missense possibly damaging 0.71
R7927:Slf2 UTSW 19 44,923,740 (GRCm39) missense probably damaging 0.97
R8006:Slf2 UTSW 19 44,930,756 (GRCm39) missense probably damaging 0.99
R8154:Slf2 UTSW 19 44,923,596 (GRCm39) missense possibly damaging 0.94
R8746:Slf2 UTSW 19 44,962,063 (GRCm39) missense probably damaging 1.00
R9075:Slf2 UTSW 19 44,930,860 (GRCm39) missense probably damaging 0.99
R9352:Slf2 UTSW 19 44,931,957 (GRCm39) missense probably null 0.97
R9354:Slf2 UTSW 19 44,936,471 (GRCm39) missense probably damaging 0.98
R9369:Slf2 UTSW 19 44,923,953 (GRCm39) nonsense probably null
R9412:Slf2 UTSW 19 44,930,460 (GRCm39) missense probably benign 0.31
R9743:Slf2 UTSW 19 44,930,572 (GRCm39) missense probably benign 0.40
R9778:Slf2 UTSW 19 44,961,666 (GRCm39) missense probably benign 0.04
Z1176:Slf2 UTSW 19 44,930,104 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGGCTTTCATGAAAGGTGGG -3'
(R):5'- CTCTCGGCAGTAAGAAGCTAATG -3'

Sequencing Primer
(F):5'- CCACAAAGATCGTGGTGTCCATG -3'
(R):5'- GCTAATGACAGCTGGAACCTAGC -3'
Posted On 2020-08-01