Incidental Mutation 'BB015:Dsn1'
ID642842
Institutional Source Beutler Lab
Gene Symbol Dsn1
Ensembl Gene ENSMUSG00000027635
Gene NameDSN1 homolog, MIS12 kinetochore complex component
Synonyms1700022L09Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.934) question?
Stock #BB015
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location156995265-157007154 bp(-) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) T to C at 157006012 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000122593 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103129] [ENSMUST00000103130] [ENSMUST00000124671] [ENSMUST00000146413] [ENSMUST00000154213]
Predicted Effect probably benign
Transcript: ENSMUST00000103129
SMART Domains Protein: ENSMUSP00000099418
Gene: ENSMUSG00000027635

DomainStartEndE-ValueType
Pfam:MIS13 72 348 4.5e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103130
SMART Domains Protein: ENSMUSP00000099419
Gene: ENSMUSG00000027635

DomainStartEndE-ValueType
Pfam:MIS13 72 348 4.5e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124671
SMART Domains Protein: ENSMUSP00000120354
Gene: ENSMUSG00000027635

DomainStartEndE-ValueType
Pfam:MIS13 72 124 2.7e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146413
SMART Domains Protein: ENSMUSP00000122524
Gene: ENSMUSG00000027635

DomainStartEndE-ValueType
Pfam:MIS13 72 199 1.7e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154213
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a kinetochore protein that functions as part of the minichromosome instability-12 centromere complex. The encoded protein is required for proper kinetochore assembly and progression through the cell cycle. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 T A 15: 74,538,321 W270R probably damaging Het
Adprhl1 C T 8: 13,248,682 V83I probably damaging Het
App A T 16: 84,978,246 V501D probably benign Het
Cnot6l A G 5: 96,131,068 V97A possibly damaging Het
Cntrob A G 11: 69,300,295 L831P probably damaging Het
Dmbt1 T C 7: 131,037,890 S53P probably benign Het
Dnah2 T C 11: 69,430,835 D3833G probably damaging Het
Dock4 T C 12: 40,788,303 L1081P probably damaging Het
Dock7 T C 4: 99,001,098 N185D Het
Evpl T C 11: 116,222,533 T1444A possibly damaging Het
Fanci T C 7: 79,444,711 L1130P probably benign Het
Fancm A G 12: 65,106,124 D1118G unknown Het
G530012D18Rik C G 1: 85,577,214 D113E unknown Het
Gm11596 A G 11: 99,792,796 V166A unknown Het
Gm2696 A T 10: 77,814,889 T70S unknown Het
Gm5773 A G 3: 93,773,690 E223G probably damaging Het
Madd T A 2: 91,176,888 D293V probably damaging Het
Odam A G 5: 87,887,410 T78A possibly damaging Het
Olfr629 T A 7: 103,741,190 I17F probably damaging Het
Rassf3 A G 10: 121,417,079 probably null Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Rhbdf1 T C 11: 32,209,898 Y826C possibly damaging Het
Rnf13 C A 3: 57,764,308 Q14K probably benign Het
Sec13 A G 6: 113,729,640 S271P probably damaging Het
Sema6c T C 3: 95,172,309 L638P probably damaging Het
Sgsh T G 11: 119,347,735 H301P probably benign Het
Shh T C 5: 28,461,406 M161V possibly damaging Het
Stil C T 4: 115,030,001 H764Y probably damaging Het
Vmn1r203 C T 13: 22,524,535 T162I probably benign Het
Zzef1 T C 11: 72,821,896 M214T probably damaging Het
Other mutations in Dsn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01572:Dsn1 APN 2 156999134 critical splice donor site probably null
IGL02425:Dsn1 APN 2 156996747 missense probably damaging 0.99
BB005:Dsn1 UTSW 2 157006012 start gained probably benign
IGL03014:Dsn1 UTSW 2 156996819 missense possibly damaging 0.94
R0421:Dsn1 UTSW 2 157005869 missense possibly damaging 0.95
R0519:Dsn1 UTSW 2 156998713 splice site probably benign
R0694:Dsn1 UTSW 2 157005869 missense possibly damaging 0.95
R1906:Dsn1 UTSW 2 156996243 missense probably damaging 1.00
R2043:Dsn1 UTSW 2 157005353 missense possibly damaging 0.47
R2930:Dsn1 UTSW 2 157005461 missense probably damaging 0.99
R4363:Dsn1 UTSW 2 156999142 missense probably benign 0.41
R4749:Dsn1 UTSW 2 157001740 missense probably damaging 1.00
R6017:Dsn1 UTSW 2 156996242 missense probably damaging 1.00
R6496:Dsn1 UTSW 2 157005267 missense probably damaging 0.97
R7562:Dsn1 UTSW 2 157000872 missense probably damaging 0.99
R7740:Dsn1 UTSW 2 156997716 missense possibly damaging 0.88
R7928:Dsn1 UTSW 2 157006012 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TGGGATAGTTCAGGAGCCTG -3'
(R):5'- CAGCCATGGCAAAATCTGG -3'

Sequencing Primer
(F):5'- GCAAGAGGCATTGAATTTCACTG -3'
(R):5'- CCATGGCAAAATCTGGAGAGAG -3'
Posted On2020-08-01