Incidental Mutation 'R0051:Syna'
ID64285
Institutional Source Beutler Lab
Gene Symbol Syna
Ensembl Gene ENSMUSG00000085957
Gene Namesyncytin a
Synonymssyncytin-A, Gm52
MMRRC Submission 038345-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0051 (G1)
Quality Score117
Status Validated
Chromosome5
Chromosomal Location134558146-134560171 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 134559543 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 184 (L184H)
Ref Sequence ENSEMBL: ENSMUSP00000116437 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000149604]
Predicted Effect probably damaging
Transcript: ENSMUST00000149604
AA Change: L184H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000116437
Gene: ENSMUSG00000085957
AA Change: L184H

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:TLV_coat 333 578 1.9e-59 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200729
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202523
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 93.8%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: Many different endogenous retrovirus families are expressed in normal placental tissue at high levels, suggesting that endogenous retroviruses are functionally important in reproduction. This gene is part of a mouse endogenous retrovirus provirus on chromosome 5 that has inactivating mutations in the gag and pol genes. This gene is the envelope glycoprotein gene which appears to have been selectively preserved. The gene's protein product plays a major role in placental development and trophoblast fusion. The protein has the characteristics of a typical retroviral envelope protein, including a cleavage site that separates the surface (SU) and transmembrane (TM) proteins which form a heterodimer. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit lethality between E11.5 and E14.5 associated with defective placental layrinth formation, impaired placental transport, and increased trophoblast cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik A G 7: 29,579,101 noncoding transcript Het
Abr T A 11: 76,472,502 Q163L probably benign Het
AI314180 A G 4: 58,832,729 L877S probably damaging Het
Ankrd11 C A 8: 122,889,742 C2457F probably damaging Het
Anks3 G C 16: 4,947,749 T163S probably benign Het
Cacna1d G A 14: 30,111,095 P908S probably damaging Het
Ccdc146 C A 5: 21,316,904 R374L possibly damaging Het
Cdc45 G T 16: 18,794,774 A348E probably damaging Het
Cfap46 A G 7: 139,676,035 C300R probably damaging Het
Coq2 T C 5: 100,663,685 N146S probably benign Het
Dalrd3 T C 9: 108,572,215 V120A possibly damaging Het
Dcp2 T A 18: 44,405,374 probably benign Het
Ddx39 A G 8: 83,720,622 K137R possibly damaging Het
Diaph3 A G 14: 87,037,454 probably null Het
Dmbt1 G T 7: 131,119,496 R1668L possibly damaging Het
Dnah7a T G 1: 53,521,086 probably benign Het
Dpp7 A G 2: 25,356,095 Y49H possibly damaging Het
Drd5 A G 5: 38,320,614 S317G probably benign Het
Ecsit C T 9: 22,076,288 V152I probably benign Het
Emc1 T A 4: 139,375,163 M923K possibly damaging Het
Fam102a G A 2: 32,558,053 R58Q possibly damaging Het
Fcrl6 A T 1: 172,598,753 L159Q probably benign Het
Frrs1 T C 3: 116,885,297 probably benign Het
Hspd1 A G 1: 55,082,046 probably benign Het
Impg2 T A 16: 56,258,048 S458T probably damaging Het
Klf17 T C 4: 117,760,392 Y256C probably damaging Het
Lnx2 A G 5: 147,029,353 F319L probably damaging Het
Mafg G T 11: 120,629,604 R57S probably damaging Het
Med13l T A 5: 118,742,655 W1271R probably damaging Het
Mrgprb1 A G 7: 48,447,214 S24P probably benign Het
Mtrf1l T C 10: 5,813,384 E315G probably damaging Het
Naip1 T C 13: 100,411,001 E1239G probably damaging Het
Ncaph2 T C 15: 89,369,664 S320P probably damaging Het
Nek11 A G 9: 105,218,539 probably benign Het
Nlrp2 A T 7: 5,322,334 probably benign Het
Odf3 C A 7: 140,850,221 probably benign Het
Rbm26 A C 14: 105,152,540 V216G possibly damaging Het
Rnf115 A G 3: 96,785,022 D178G probably damaging Het
Rtel1 C T 2: 181,350,656 Q424* probably null Het
Rwdd4a A G 8: 47,537,365 probably benign Het
Ryr3 T C 2: 112,869,075 D890G probably damaging Het
Scarb1 C A 5: 125,281,100 probably null Het
Serpina10 A G 12: 103,626,897 probably benign Het
Slc12a5 T A 2: 164,986,663 W508R probably damaging Het
Slc43a2 T C 11: 75,562,850 C225R probably damaging Het
Slc6a9 T C 4: 117,864,859 F440L probably damaging Het
Stac3 G A 10: 127,508,148 R305H probably damaging Het
Stk32b A G 5: 37,459,596 probably benign Het
Tmprss7 T C 16: 45,673,939 N401S probably damaging Het
Yeats2 T A 16: 20,193,724 Y557* probably null Het
Zcchc11 T G 4: 108,527,004 S1089R probably damaging Het
Zfp352 T C 4: 90,224,285 S221P probably damaging Het
Zfp575 A G 7: 24,586,087 V43A probably benign Het
Zfp775 A G 6: 48,620,772 T527A probably benign Het
Other mutations in Syna
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Syna APN 5 134559717 missense possibly damaging 0.94
IGL01128:Syna APN 5 134559480 missense probably damaging 0.99
IGL03183:Syna APN 5 134558290 missense probably benign 0.03
R0051:Syna UTSW 5 134559543 missense probably damaging 0.99
R0137:Syna UTSW 5 134559460 missense possibly damaging 0.93
R0920:Syna UTSW 5 134559102 missense probably benign 0.12
R1525:Syna UTSW 5 134559258 missense probably benign
R1801:Syna UTSW 5 134560089 missense probably benign 0.02
R1813:Syna UTSW 5 134559152 missense probably benign 0.06
R1866:Syna UTSW 5 134559915 missense probably damaging 1.00
R1887:Syna UTSW 5 134559252 missense probably benign
R1896:Syna UTSW 5 134559152 missense probably benign 0.06
R2139:Syna UTSW 5 134559252 nonsense probably null
R3896:Syna UTSW 5 134558311 nonsense probably null
R4674:Syna UTSW 5 134558355 missense probably damaging 0.99
R4730:Syna UTSW 5 134558586 missense probably damaging 1.00
R5124:Syna UTSW 5 134559570 missense possibly damaging 0.65
R5482:Syna UTSW 5 134559174 missense possibly damaging 0.94
R6130:Syna UTSW 5 134558268 missense possibly damaging 0.72
R6196:Syna UTSW 5 134559612 missense probably benign 0.14
R6243:Syna UTSW 5 134560114 start gained probably benign
R6945:Syna UTSW 5 134558961 missense probably damaging 0.97
R7999:Syna UTSW 5 134559192 missense probably benign
R8320:Syna UTSW 5 134559720 missense possibly damaging 0.86
X0022:Syna UTSW 5 134559573 missense probably benign 0.01
Z1088:Syna UTSW 5 134558529 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCTCGAATTGTCCGGCTCGAATAG -3'
(R):5'- GCGTGACAGGCATACTTCCCATAC -3'

Sequencing Primer
(F):5'- ATGTCATCTATCGGGCAGGAG -3'
(R):5'- ATACTTTCTCGGATCACCTCGG -3'
Posted On2013-08-06