Incidental Mutation 'BB015:Adprhl1'
ID642855
Institutional Source Beutler Lab
Gene Symbol Adprhl1
Ensembl Gene ENSMUSG00000031448
Gene NameADP-ribosylhydrolase like 1
SynonymsArh2, D330008N11Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #BB015
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location13221663-13254162 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 13248682 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 83 (V83I)
Ref Sequence ENSEMBL: ENSMUSP00000033825 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033825] [ENSMUST00000168498] [ENSMUST00000171619] [ENSMUST00000204916]
Predicted Effect probably damaging
Transcript: ENSMUST00000033825
AA Change: V83I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000033825
Gene: ENSMUSG00000031448
AA Change: V83I

DomainStartEndE-ValueType
Pfam:ADP_ribosyl_GH 6 327 1.2e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168498
SMART Domains Protein: ENSMUSP00000131920
Gene: ENSMUSG00000031448

DomainStartEndE-ValueType
Pfam:ADP_ribosyl_GH 69 196 9e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000171619
AA Change: V2I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132014
Gene: ENSMUSG00000031448
AA Change: V2I

DomainStartEndE-ValueType
Pfam:ADP_ribosyl_GH 1 135 4.9e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000204916
AA Change: V83I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000145145
Gene: ENSMUSG00000031448
AA Change: V83I

DomainStartEndE-ValueType
Pfam:ADP_ribosyl_GH 6 327 4.2e-49 PFAM
low complexity region 509 527 N/A INTRINSIC
low complexity region 955 969 N/A INTRINSIC
internal_repeat_1 1047 1150 1.82e-5 PROSPERO
internal_repeat_1 1157 1274 1.82e-5 PROSPERO
low complexity region 1275 1290 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ADP-ribosylation is a reversible posttranslational modification used to regulate protein function. ADP-ribosyltransferases (see ART1; MIM 601625) transfer ADP-ribose from NAD+ to the target protein, and ADP-ribosylhydrolases, such as ADPRHL1, reverse the reaction (Glowacki et al., 2002 [PubMed 12070318]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 T A 15: 74,538,321 W270R probably damaging Het
App A T 16: 84,978,246 V501D probably benign Het
Cnot6l A G 5: 96,131,068 V97A possibly damaging Het
Cntrob A G 11: 69,300,295 L831P probably damaging Het
Dmbt1 T C 7: 131,037,890 S53P probably benign Het
Dnah2 T C 11: 69,430,835 D3833G probably damaging Het
Dock4 T C 12: 40,788,303 L1081P probably damaging Het
Dock7 T C 4: 99,001,098 N185D Het
Dsn1 T C 2: 157,006,012 probably benign Het
Evpl T C 11: 116,222,533 T1444A possibly damaging Het
Fanci T C 7: 79,444,711 L1130P probably benign Het
Fancm A G 12: 65,106,124 D1118G unknown Het
G530012D18Rik C G 1: 85,577,214 D113E unknown Het
Gm11596 A G 11: 99,792,796 V166A unknown Het
Gm2696 A T 10: 77,814,889 T70S unknown Het
Gm5773 A G 3: 93,773,690 E223G probably damaging Het
Madd T A 2: 91,176,888 D293V probably damaging Het
Odam A G 5: 87,887,410 T78A possibly damaging Het
Olfr629 T A 7: 103,741,190 I17F probably damaging Het
Rassf3 A G 10: 121,417,079 probably null Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Rhbdf1 T C 11: 32,209,898 Y826C possibly damaging Het
Rnf13 C A 3: 57,764,308 Q14K probably benign Het
Sec13 A G 6: 113,729,640 S271P probably damaging Het
Sema6c T C 3: 95,172,309 L638P probably damaging Het
Sgsh T G 11: 119,347,735 H301P probably benign Het
Shh T C 5: 28,461,406 M161V possibly damaging Het
Stil C T 4: 115,030,001 H764Y probably damaging Het
Vmn1r203 C T 13: 22,524,535 T162I probably benign Het
Zzef1 T C 11: 72,821,896 M214T probably damaging Het
Other mutations in Adprhl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03268:Adprhl1 APN 8 13246170 splice site probably benign
BB003:Adprhl1 UTSW 8 13248682 missense probably damaging 1.00
BB004:Adprhl1 UTSW 8 13248682 missense probably damaging 1.00
BB005:Adprhl1 UTSW 8 13248682 missense probably damaging 1.00
BB006:Adprhl1 UTSW 8 13248682 missense probably damaging 1.00
BB013:Adprhl1 UTSW 8 13248682 missense probably damaging 1.00
BB014:Adprhl1 UTSW 8 13248682 missense probably damaging 1.00
BB016:Adprhl1 UTSW 8 13248682 missense probably damaging 1.00
R0244:Adprhl1 UTSW 8 13242391 splice site probably benign
R0636:Adprhl1 UTSW 8 13248702 missense probably damaging 1.00
R1295:Adprhl1 UTSW 8 13248624 missense probably damaging 1.00
R2111:Adprhl1 UTSW 8 13248694 missense probably damaging 1.00
R2112:Adprhl1 UTSW 8 13248694 missense probably damaging 1.00
R2184:Adprhl1 UTSW 8 13242559 missense probably benign 0.00
R4411:Adprhl1 UTSW 8 13246114 missense probably benign 0.16
R4412:Adprhl1 UTSW 8 13246114 missense probably benign 0.16
R4413:Adprhl1 UTSW 8 13246114 missense probably benign 0.16
R4615:Adprhl1 UTSW 8 13242250 critical splice donor site probably null
R4618:Adprhl1 UTSW 8 13242250 critical splice donor site probably null
R5016:Adprhl1 UTSW 8 13224889 missense possibly damaging 0.88
R5058:Adprhl1 UTSW 8 13242625 missense probably damaging 1.00
R5060:Adprhl1 UTSW 8 13248621 missense possibly damaging 0.63
R5209:Adprhl1 UTSW 8 13242563 nonsense probably null
R6103:Adprhl1 UTSW 8 13222055 missense possibly damaging 0.91
R6158:Adprhl1 UTSW 8 13224977 missense possibly damaging 0.93
R6221:Adprhl1 UTSW 8 13225634 missense probably benign 0.01
R6971:Adprhl1 UTSW 8 13223476 missense probably benign
R7087:Adprhl1 UTSW 8 13221856 missense probably damaging 0.99
R7362:Adprhl1 UTSW 8 13245534 missense probably damaging 1.00
R7404:Adprhl1 UTSW 8 13225118 missense probably damaging 0.99
R7422:Adprhl1 UTSW 8 13222873 missense probably benign 0.28
R7439:Adprhl1 UTSW 8 13223069 missense probably benign 0.01
R7441:Adprhl1 UTSW 8 13223069 missense probably benign 0.01
R7772:Adprhl1 UTSW 8 13248682 missense probably damaging 1.00
R7773:Adprhl1 UTSW 8 13248682 missense probably damaging 1.00
R7774:Adprhl1 UTSW 8 13248682 missense probably damaging 1.00
R7776:Adprhl1 UTSW 8 13248682 missense probably damaging 1.00
R7876:Adprhl1 UTSW 8 13223509 missense probably benign 0.00
R7877:Adprhl1 UTSW 8 13225316 nonsense probably null
R7926:Adprhl1 UTSW 8 13248682 missense probably damaging 1.00
R7927:Adprhl1 UTSW 8 13248682 missense probably damaging 1.00
R7928:Adprhl1 UTSW 8 13248682 missense probably damaging 1.00
R7929:Adprhl1 UTSW 8 13248682 missense probably damaging 1.00
R7944:Adprhl1 UTSW 8 13221929 missense probably damaging 0.99
R7945:Adprhl1 UTSW 8 13221929 missense probably damaging 0.99
R7946:Adprhl1 UTSW 8 13248682 missense probably damaging 1.00
R7947:Adprhl1 UTSW 8 13248682 missense probably damaging 1.00
R7949:Adprhl1 UTSW 8 13224225 missense possibly damaging 0.93
R8155:Adprhl1 UTSW 8 13221764 missense probably damaging 0.99
R8182:Adprhl1 UTSW 8 13222774 missense probably benign 0.07
Z1176:Adprhl1 UTSW 8 13225613 missense probably benign 0.01
Z1177:Adprhl1 UTSW 8 13245476 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- TCCCTAACTGCAGCTCTGTG -3'
(R):5'- TCCAAGTAGTTGAGACTGTTAGAAG -3'

Sequencing Primer
(F):5'- TAACTGCAGCTCTGTGAACAG -3'
(R):5'- TGGTGGATGTTCCCTAGACCC -3'
Posted On2020-08-01