Incidental Mutation 'BB015:Rhbdf1'
ID642858
Institutional Source Beutler Lab
Gene Symbol Rhbdf1
Ensembl Gene ENSMUSG00000020282
Gene Namerhomboid 5 homolog 1
SynonymsDist, Dist1, Egfr-rs
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock #BB015
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location32209585-32222300 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32209898 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 826 (Y826C)
Ref Sequence ENSEMBL: ENSMUSP00000020524 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020524] [ENSMUST00000039601] [ENSMUST00000121182] [ENSMUST00000132578] [ENSMUST00000143988] [ENSMUST00000146179] [ENSMUST00000149043]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020524
AA Change: Y826C

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000020524
Gene: ENSMUSG00000020282
AA Change: Y826C

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
Pfam:Rhomboid_SP 91 308 1.6e-116 PFAM
Pfam:Rhomboid 648 792 2.1e-32 PFAM
transmembrane domain 805 827 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000039601
SMART Domains Protein: ENSMUSP00000046654
Gene: ENSMUSG00000040767

DomainStartEndE-ValueType
PDB:1V2Y|A 31 123 4e-63 PDB
Blast:UBQ 32 119 1e-30 BLAST
SCOP:d1euvb_ 32 121 3e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121182
SMART Domains Protein: ENSMUSP00000112483
Gene: ENSMUSG00000040767

DomainStartEndE-ValueType
PDB:1V2Y|A 31 83 4e-28 PDB
Blast:UBQ 32 83 2e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000132578
SMART Domains Protein: ENSMUSP00000120543
Gene: ENSMUSG00000020282

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
Pfam:Rhomboid_SP 91 158 7.9e-35 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000143988
AA Change: Y201C

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000117471
Gene: ENSMUSG00000020282
AA Change: Y201C

DomainStartEndE-ValueType
Pfam:Rhomboid 52 167 1.6e-24 PFAM
transmembrane domain 181 203 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146179
SMART Domains Protein: ENSMUSP00000118985
Gene: ENSMUSG00000020282

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
Pfam:Rhomboid_SP 91 155 7.1e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149043
SMART Domains Protein: ENSMUSP00000119306
Gene: ENSMUSG00000040767

DomainStartEndE-ValueType
PDB:1V2Y|A 31 96 1e-40 PDB
Blast:UBQ 32 96 3e-15 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for a null allele show pleiotropic phenotypes and postnatal lethality largely dependent on the genetic background. Observed defects range from small size, reduced fat mass, and brain haemorrhages to small lymph organs, thrombosis, abnormal pancreatic acini, and behavioral deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 T A 15: 74,538,321 W270R probably damaging Het
Adprhl1 C T 8: 13,248,682 V83I probably damaging Het
App A T 16: 84,978,246 V501D probably benign Het
Cnot6l A G 5: 96,131,068 V97A possibly damaging Het
Cntrob A G 11: 69,300,295 L831P probably damaging Het
Dmbt1 T C 7: 131,037,890 S53P probably benign Het
Dnah2 T C 11: 69,430,835 D3833G probably damaging Het
Dock4 T C 12: 40,788,303 L1081P probably damaging Het
Dock7 T C 4: 99,001,098 N185D Het
Dsn1 T C 2: 157,006,012 probably benign Het
Evpl T C 11: 116,222,533 T1444A possibly damaging Het
Fanci T C 7: 79,444,711 L1130P probably benign Het
Fancm A G 12: 65,106,124 D1118G unknown Het
G530012D18Rik C G 1: 85,577,214 D113E unknown Het
Gm11596 A G 11: 99,792,796 V166A unknown Het
Gm2696 A T 10: 77,814,889 T70S unknown Het
Gm5773 A G 3: 93,773,690 E223G probably damaging Het
Madd T A 2: 91,176,888 D293V probably damaging Het
Odam A G 5: 87,887,410 T78A possibly damaging Het
Olfr629 T A 7: 103,741,190 I17F probably damaging Het
Rassf3 A G 10: 121,417,079 probably null Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Rnf13 C A 3: 57,764,308 Q14K probably benign Het
Sec13 A G 6: 113,729,640 S271P probably damaging Het
Sema6c T C 3: 95,172,309 L638P probably damaging Het
Sgsh T G 11: 119,347,735 H301P probably benign Het
Shh T C 5: 28,461,406 M161V possibly damaging Het
Stil C T 4: 115,030,001 H764Y probably damaging Het
Vmn1r203 C T 13: 22,524,535 T162I probably benign Het
Zzef1 T C 11: 72,821,896 M214T probably damaging Het
Other mutations in Rhbdf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01863:Rhbdf1 APN 11 32213484 missense probably benign
IGL02183:Rhbdf1 APN 11 32210543 missense probably damaging 1.00
IGL02793:Rhbdf1 APN 11 32213293 missense possibly damaging 0.92
IGL02875:Rhbdf1 APN 11 32213293 missense possibly damaging 0.92
BB005:Rhbdf1 UTSW 11 32209898 missense possibly damaging 0.93
FR4589:Rhbdf1 UTSW 11 32214391 unclassified probably benign
R0071:Rhbdf1 UTSW 11 32210498 missense probably damaging 1.00
R0180:Rhbdf1 UTSW 11 32210042 missense possibly damaging 0.76
R0512:Rhbdf1 UTSW 11 32210875 nonsense probably null
R0843:Rhbdf1 UTSW 11 32215053 missense probably damaging 1.00
R0880:Rhbdf1 UTSW 11 32213432 splice site probably null
R1952:Rhbdf1 UTSW 11 32214277 nonsense probably null
R2017:Rhbdf1 UTSW 11 32210471 missense probably damaging 1.00
R2076:Rhbdf1 UTSW 11 32214088 missense probably benign 0.01
R3032:Rhbdf1 UTSW 11 32209985 missense probably damaging 1.00
R4355:Rhbdf1 UTSW 11 32216236 missense probably damaging 1.00
R4429:Rhbdf1 UTSW 11 32213369 missense probably benign 0.00
R4865:Rhbdf1 UTSW 11 32214517 missense probably damaging 1.00
R5585:Rhbdf1 UTSW 11 32210222 splice site probably null
R5728:Rhbdf1 UTSW 11 32209901 splice site probably null
R5925:Rhbdf1 UTSW 11 32212906 missense probably benign 0.24
R5940:Rhbdf1 UTSW 11 32209847 missense probably benign 0.00
R6083:Rhbdf1 UTSW 11 32210066 missense probably damaging 1.00
R6088:Rhbdf1 UTSW 11 32212007 missense possibly damaging 0.62
R6361:Rhbdf1 UTSW 11 32212915 missense possibly damaging 0.92
R6692:Rhbdf1 UTSW 11 32215652 missense probably damaging 0.98
R6727:Rhbdf1 UTSW 11 32214042 missense possibly damaging 0.78
R6825:Rhbdf1 UTSW 11 32209970 missense probably damaging 1.00
R7589:Rhbdf1 UTSW 11 32212903 missense probably benign 0.01
R7928:Rhbdf1 UTSW 11 32209898 missense possibly damaging 0.93
R7940:Rhbdf1 UTSW 11 32216258 start codon destroyed possibly damaging 0.79
R7957:Rhbdf1 UTSW 11 32210523 missense probably damaging 1.00
R8220:Rhbdf1 UTSW 11 32214563 missense probably benign 0.30
V3553:Rhbdf1 UTSW 11 32211583 missense probably damaging 1.00
Z1176:Rhbdf1 UTSW 11 32215125 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ACTAAATGCCCAGCAGTGTAAG -3'
(R):5'- TGCCCTGGATCGACAACTTC -3'

Sequencing Primer
(F):5'- TGCCCAGCAGTGTAAGCGTAC -3'
(R):5'- AACTTCGCCCACATCTCGGG -3'
Posted On2020-08-01