Incidental Mutation 'BB015:Cntrob'
ID 642859
Institutional Source Beutler Lab
Gene Symbol Cntrob
Ensembl Gene ENSMUSG00000032782
Gene Name centrobin, centrosomal BRCA2 interacting protein
Synonyms Nip2, 9830165K03Rik, Lip8
Accession Numbers
Essential gene? Probably non essential (E-score: 0.175) question?
Stock # BB015
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 69190313-69214601 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 69191121 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 831 (L831P)
Ref Sequence ENSEMBL: ENSMUSP00000090651 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092973] [ENSMUST00000123176] [ENSMUST00000130780]
AlphaFold Q8CB62
Predicted Effect probably damaging
Transcript: ENSMUST00000092973
AA Change: L831P

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000090651
Gene: ENSMUSG00000032782
AA Change: L831P

DomainStartEndE-ValueType
coiled coil region 191 218 N/A INTRINSIC
coiled coil region 249 557 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123176
Predicted Effect silent
Transcript: ENSMUST00000130780
SMART Domains Protein: ENSMUSP00000134842
Gene: ENSMUSG00000032782

DomainStartEndE-ValueType
low complexity region 50 64 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176938
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a centrosomal protein that interacts with BRCA2, and is required for centriole duplication and cytokinesis. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 T A 15: 74,410,170 (GRCm39) W270R probably damaging Het
Adprhl1 C T 8: 13,298,682 (GRCm39) V83I probably damaging Het
App A T 16: 84,775,134 (GRCm39) V501D probably benign Het
Cnot6l A G 5: 96,278,927 (GRCm39) V97A possibly damaging Het
Dmbt1 T C 7: 130,639,620 (GRCm39) S53P probably benign Het
Dnah2 T C 11: 69,321,661 (GRCm39) D3833G probably damaging Het
Dock4 T C 12: 40,838,302 (GRCm39) L1081P probably damaging Het
Dock7 T C 4: 98,889,335 (GRCm39) N185D Het
Dsn1 T C 2: 156,847,932 (GRCm39) probably benign Het
Evpl T C 11: 116,113,359 (GRCm39) T1444A possibly damaging Het
Fanci T C 7: 79,094,459 (GRCm39) L1130P probably benign Het
Fancm A G 12: 65,152,898 (GRCm39) D1118G unknown Het
G530012D18Rik C G 1: 85,504,935 (GRCm39) D113E unknown Het
Gm11596 A G 11: 99,683,622 (GRCm39) V166A unknown Het
Gm2696 A T 10: 77,650,723 (GRCm39) T70S unknown Het
Gm5773 A G 3: 93,680,997 (GRCm39) E223G probably damaging Het
Madd T A 2: 91,007,233 (GRCm39) D293V probably damaging Het
Odam A G 5: 88,035,269 (GRCm39) T78A possibly damaging Het
Or52ae9 T A 7: 103,390,397 (GRCm39) I17F probably damaging Het
Rassf3 A G 10: 121,252,984 (GRCm39) probably null Het
Rftn1 G T 17: 50,354,408 (GRCm39) A318D probably damaging Het
Rhbdf1 T C 11: 32,159,898 (GRCm39) Y826C possibly damaging Het
Rnf13 C A 3: 57,671,729 (GRCm39) Q14K probably benign Het
Sec13 A G 6: 113,706,601 (GRCm39) S271P probably damaging Het
Sema6c T C 3: 95,079,620 (GRCm39) L638P probably damaging Het
Sgsh T G 11: 119,238,561 (GRCm39) H301P probably benign Het
Shh T C 5: 28,666,404 (GRCm39) M161V possibly damaging Het
Stil C T 4: 114,887,198 (GRCm39) H764Y probably damaging Het
Vmn1r203 C T 13: 22,708,705 (GRCm39) T162I probably benign Het
Zzef1 T C 11: 72,712,722 (GRCm39) M214T probably damaging Het
Other mutations in Cntrob
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02975:Cntrob APN 11 69,210,199 (GRCm39) missense possibly damaging 0.66
IGL03173:Cntrob APN 11 69,200,853 (GRCm39) missense possibly damaging 0.90
groats UTSW 11 69,200,317 (GRCm39) nonsense probably null
BB005:Cntrob UTSW 11 69,191,121 (GRCm39) missense probably damaging 0.97
R0270:Cntrob UTSW 11 69,202,167 (GRCm39) missense possibly damaging 0.66
R0501:Cntrob UTSW 11 69,213,694 (GRCm39) missense probably damaging 1.00
R1749:Cntrob UTSW 11 69,213,700 (GRCm39) missense probably damaging 0.99
R1775:Cntrob UTSW 11 69,211,693 (GRCm39) missense possibly damaging 0.90
R1900:Cntrob UTSW 11 69,198,880 (GRCm39) missense probably benign 0.27
R1967:Cntrob UTSW 11 69,211,789 (GRCm39) missense probably damaging 0.97
R2495:Cntrob UTSW 11 69,213,749 (GRCm39) missense probably damaging 0.96
R3121:Cntrob UTSW 11 69,213,526 (GRCm39) nonsense probably null
R3780:Cntrob UTSW 11 69,193,708 (GRCm39) missense probably damaging 0.97
R4449:Cntrob UTSW 11 69,196,375 (GRCm39) missense probably benign 0.29
R4696:Cntrob UTSW 11 69,211,714 (GRCm39) missense probably damaging 1.00
R4841:Cntrob UTSW 11 69,206,220 (GRCm39) missense possibly damaging 0.92
R4842:Cntrob UTSW 11 69,206,220 (GRCm39) missense possibly damaging 0.92
R4908:Cntrob UTSW 11 69,211,732 (GRCm39) missense probably damaging 0.97
R4982:Cntrob UTSW 11 69,202,188 (GRCm39) splice site probably null
R5168:Cntrob UTSW 11 69,190,816 (GRCm39) missense possibly damaging 0.66
R5187:Cntrob UTSW 11 69,212,717 (GRCm39) missense possibly damaging 0.62
R5307:Cntrob UTSW 11 69,205,576 (GRCm39) missense possibly damaging 0.66
R5473:Cntrob UTSW 11 69,213,579 (GRCm39) missense possibly damaging 0.81
R5903:Cntrob UTSW 11 69,200,201 (GRCm39) missense possibly damaging 0.83
R6643:Cntrob UTSW 11 69,202,248 (GRCm39) missense possibly damaging 0.46
R6742:Cntrob UTSW 11 69,213,749 (GRCm39) missense probably damaging 0.96
R6964:Cntrob UTSW 11 69,200,317 (GRCm39) nonsense probably null
R7020:Cntrob UTSW 11 69,193,918 (GRCm39) critical splice donor site probably null
R7425:Cntrob UTSW 11 69,205,560 (GRCm39) nonsense probably null
R7928:Cntrob UTSW 11 69,191,121 (GRCm39) missense probably damaging 0.97
R7946:Cntrob UTSW 11 69,206,047 (GRCm39) missense possibly damaging 0.82
R8348:Cntrob UTSW 11 69,190,679 (GRCm39) missense unknown
R8448:Cntrob UTSW 11 69,190,679 (GRCm39) missense unknown
R8539:Cntrob UTSW 11 69,211,652 (GRCm39) missense possibly damaging 0.94
R9259:Cntrob UTSW 11 69,211,665 (GRCm39) missense possibly damaging 0.81
R9415:Cntrob UTSW 11 69,193,741 (GRCm39) missense possibly damaging 0.66
R9553:Cntrob UTSW 11 69,205,679 (GRCm39) missense probably benign 0.00
R9626:Cntrob UTSW 11 69,202,167 (GRCm39) missense possibly damaging 0.66
R9628:Cntrob UTSW 11 69,213,782 (GRCm39) missense possibly damaging 0.66
R9801:Cntrob UTSW 11 69,212,233 (GRCm39) missense possibly damaging 0.82
Z1177:Cntrob UTSW 11 69,202,275 (GRCm39) missense possibly damaging 0.66
Z1186:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1186:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Z1187:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1187:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Z1188:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1188:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Z1189:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1189:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Z1190:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1190:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Z1191:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1191:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Z1192:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1192:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTTAGGGACTGAAGCAAGGC -3'
(R):5'- ACTAGAAGGCTCTCCCAGACTC -3'

Sequencing Primer
(F):5'- CATGGTGTACGGAGAGGCTC -3'
(R):5'- GACACGATTTCTAAGTATAGCCCTGG -3'
Posted On 2020-08-01