Mutagenetix > Incidental Mutation

Incidental Mutation 'BB015:Evpl'

642863

Institutional Source

Beutler Lab

Gene Symbol

Evpl

Ensembl Gene

ENSMUSG00000034282

Gene Name

envoplakin

Synonyms

210kDa protein

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

BB015

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

116111385-116128903 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 116113359 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 1444 (T1444A)

Ref Sequence

ENSEMBL: ENSMUSP00000037850 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037007] [ENSMUST00000174177]

AlphaFold

Q9D952

Predicted Effect

possibly damaging
Transcript: ENSMUST00000037007
AA Change: T1444A

PolyPhen 2 Score 0.630 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000037850
Gene: ENSMUSG00000034282
AA Change: T1444A

Domain	Start	End	E-Value	Type
low complexity region	3	30	N/A	INTRINSIC
Blast:SPEC	44	140	1e-16	BLAST
Blast:SPEC	140	226	4e-46	BLAST
SPEC	229	330	2.21e-6	SMART
Blast:SPEC	336	500	7e-68	BLAST
low complexity region	508	525	N/A	INTRINSIC
Blast:SPEC	527	632	4e-41	BLAST
Blast:SPEC	635	746	5e-48	BLAST
Blast:SPEC	753	867	7e-49	BLAST
low complexity region	868	881	N/A	INTRINSIC
low complexity region	933	950	N/A	INTRINSIC
internal_repeat_2	1011	1030	6.54e-6	PROSPERO
internal_repeat_3	1012	1032	1.94e-5	PROSPERO
coiled coil region	1035	1077	N/A	INTRINSIC
low complexity region	1131	1144	N/A	INTRINSIC
low complexity region	1149	1164	N/A	INTRINSIC
PLEC	1186	1227	1.48e2	SMART
low complexity region	1228	1242	N/A	INTRINSIC
coiled coil region	1262	1366	N/A	INTRINSIC
low complexity region	1398	1414	N/A	INTRINSIC
internal_repeat_2	1457	1476	6.54e-6	PROSPERO
internal_repeat_3	1516	1536	1.94e-5	PROSPERO
low complexity region	1595	1617	N/A	INTRINSIC
PLEC	1679	1714	9.19e-4	SMART
PLEC	1729	1764	4.53e1	SMART
low complexity region	1788	1800	N/A	INTRINSIC
PLEC	1819	1856	1.41e-4	SMART
PLEC	1857	1894	5.4e-10	SMART
PLEC	1895	1932	2.7e-10	SMART
PLEC	1933	1970	1.21e-3	SMART
PLEC	1971	2008	1.16e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000174177

SMART Domains

Protein: ENSMUSP00000134251
Gene: ENSMUSG00000092300

Domain	Start	End	E-Value	Type
S_TKc	4	285	4e-105	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the plakin family of proteins that forms a component of desmosomes and the epidermal cornified envelope. This gene is located in the tylosis oesophageal cancer locus on chromosome 17q25, and its deletion is associated with both familial and sporadic forms of oesophageal squamous cell carcinoma. Patients suffering from the autoimmune mucocutaneous disorder, paraneoplastic pemphigus, develop antibodies against the encoded protein. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a targeted deletion of this gene are viable and fertile. Surprisingly, cornified envelope assembly is not inhibited and adult homozygotes show no obvious pathological phenotype in skin or other epithelia, despite a slight delay in barrier acquisition during embryonic development. [provided by MGI curators]

Allele List at MGI

All alleles(3) : Targeted, other(3)

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrb1	T	A	15: 74,410,170 (GRCm39)	W270R	probably damaging	Het
Adprhl1	C	T	8: 13,298,682 (GRCm39)	V83I	probably damaging	Het
App	A	T	16: 84,775,134 (GRCm39)	V501D	probably benign	Het
Cnot6l	A	G	5: 96,278,927 (GRCm39)	V97A	possibly damaging	Het
Cntrob	A	G	11: 69,191,121 (GRCm39)	L831P	probably damaging	Het
Dmbt1	T	C	7: 130,639,620 (GRCm39)	S53P	probably benign	Het
Dnah2	T	C	11: 69,321,661 (GRCm39)	D3833G	probably damaging	Het
Dock4	T	C	12: 40,838,302 (GRCm39)	L1081P	probably damaging	Het
Dock7	T	C	4: 98,889,335 (GRCm39)	N185D		Het
Dsn1	T	C	2: 156,847,932 (GRCm39)		probably benign	Het
Fanci	T	C	7: 79,094,459 (GRCm39)	L1130P	probably benign	Het
Fancm	A	G	12: 65,152,898 (GRCm39)	D1118G	unknown	Het
G530012D18Rik	C	G	1: 85,504,935 (GRCm39)	D113E	unknown	Het
Gm11596	A	G	11: 99,683,622 (GRCm39)	V166A	unknown	Het
Gm2696	A	T	10: 77,650,723 (GRCm39)	T70S	unknown	Het
Gm5773	A	G	3: 93,680,997 (GRCm39)	E223G	probably damaging	Het
Madd	T	A	2: 91,007,233 (GRCm39)	D293V	probably damaging	Het
Odam	A	G	5: 88,035,269 (GRCm39)	T78A	possibly damaging	Het
Or52ae9	T	A	7: 103,390,397 (GRCm39)	I17F	probably damaging	Het
Rassf3	A	G	10: 121,252,984 (GRCm39)		probably null	Het
Rftn1	G	T	17: 50,354,408 (GRCm39)	A318D	probably damaging	Het
Rhbdf1	T	C	11: 32,159,898 (GRCm39)	Y826C	possibly damaging	Het
Rnf13	C	A	3: 57,671,729 (GRCm39)	Q14K	probably benign	Het
Sec13	A	G	6: 113,706,601 (GRCm39)	S271P	probably damaging	Het
Sema6c	T	C	3: 95,079,620 (GRCm39)	L638P	probably damaging	Het
Sgsh	T	G	11: 119,238,561 (GRCm39)	H301P	probably benign	Het
Shh	T	C	5: 28,666,404 (GRCm39)	M161V	possibly damaging	Het
Stil	C	T	4: 114,887,198 (GRCm39)	H764Y	probably damaging	Het
Vmn1r203	C	T	13: 22,708,705 (GRCm39)	T162I	probably benign	Het
Zzef1	T	C	11: 72,712,722 (GRCm39)	M214T	probably damaging	Het

Other mutations in Evpl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00427:Evpl	APN	11	116,125,331 (GRCm39)	missense	probably benign	0.01
IGL00896:Evpl	APN	11	116,113,410 (GRCm39)	nonsense	probably null
IGL00941:Evpl	APN	11	116,118,727 (GRCm39)	missense	probably benign	0.06
IGL01443:Evpl	APN	11	116,113,280 (GRCm39)	missense	probably damaging	1.00
IGL01523:Evpl	APN	11	116,124,270 (GRCm39)	missense	probably damaging	1.00
IGL01957:Evpl	APN	11	116,114,048 (GRCm39)	missense	probably damaging	1.00
IGL02124:Evpl	APN	11	116,117,841 (GRCm39)	missense	probably benign	0.01
IGL02334:Evpl	APN	11	116,121,850 (GRCm39)	nonsense	probably null
IGL02457:Evpl	APN	11	116,120,939 (GRCm39)	missense	possibly damaging	0.87
IGL02502:Evpl	APN	11	116,113,544 (GRCm39)	missense	probably damaging	1.00
IGL02536:Evpl	APN	11	116,112,035 (GRCm39)	missense	probably damaging	1.00
IGL02948:Evpl	APN	11	116,112,648 (GRCm39)	missense	probably damaging	1.00
IGL03183:Evpl	APN	11	116,112,438 (GRCm39)	missense	probably damaging	0.98
IGL03405:Evpl	APN	11	116,118,753 (GRCm39)	missense	possibly damaging	0.89
A4554:Evpl	UTSW	11	116,111,660 (GRCm39)	missense	probably damaging	1.00
BB005:Evpl	UTSW	11	116,113,359 (GRCm39)	missense	possibly damaging	0.63
PIT4449001:Evpl	UTSW	11	116,124,225 (GRCm39)	missense	possibly damaging	0.87
R0082:Evpl	UTSW	11	116,125,829 (GRCm39)	missense	probably damaging	1.00
R0108:Evpl	UTSW	11	116,111,702 (GRCm39)	missense	probably damaging	1.00
R0514:Evpl	UTSW	11	116,114,117 (GRCm39)	missense	probably damaging	0.99
R0581:Evpl	UTSW	11	116,120,316 (GRCm39)	missense	probably benign	0.02
R0727:Evpl	UTSW	11	116,123,311 (GRCm39)	missense	probably damaging	1.00
R0791:Evpl	UTSW	11	116,118,549 (GRCm39)	missense	probably damaging	1.00
R0792:Evpl	UTSW	11	116,118,549 (GRCm39)	missense	probably damaging	1.00
R1079:Evpl	UTSW	11	116,120,894 (GRCm39)	missense	possibly damaging	0.48
R1514:Evpl	UTSW	11	116,114,661 (GRCm39)	missense	probably benign
R1699:Evpl	UTSW	11	116,118,414 (GRCm39)	missense	probably damaging	1.00
R1717:Evpl	UTSW	11	116,116,318 (GRCm39)	missense	probably benign	0.06
R1775:Evpl	UTSW	11	116,114,486 (GRCm39)	missense	possibly damaging	0.66
R1886:Evpl	UTSW	11	116,118,402 (GRCm39)	missense	probably damaging	0.97
R1903:Evpl	UTSW	11	116,117,854 (GRCm39)	missense	probably damaging	1.00
R2081:Evpl	UTSW	11	116,125,092 (GRCm39)	missense	probably damaging	1.00
R2137:Evpl	UTSW	11	116,112,665 (GRCm39)	missense	probably damaging	0.99
R2571:Evpl	UTSW	11	116,128,795 (GRCm39)	missense	unknown
R3081:Evpl	UTSW	11	116,111,678 (GRCm39)	missense	probably damaging	1.00
R4097:Evpl	UTSW	11	116,114,003 (GRCm39)	missense	possibly damaging	0.89
R4541:Evpl	UTSW	11	116,123,470 (GRCm39)	missense	probably benign	0.01
R4562:Evpl	UTSW	11	116,124,225 (GRCm39)	missense	possibly damaging	0.87
R4703:Evpl	UTSW	11	116,113,331 (GRCm39)	missense	probably damaging	0.98
R4947:Evpl	UTSW	11	116,114,201 (GRCm39)	missense	possibly damaging	0.88
R5243:Evpl	UTSW	11	116,113,795 (GRCm39)	missense	probably damaging	1.00
R5325:Evpl	UTSW	11	116,112,191 (GRCm39)	missense	probably damaging	1.00
R5416:Evpl	UTSW	11	116,125,085 (GRCm39)	missense	probably benign	0.13
R5580:Evpl	UTSW	11	116,125,058 (GRCm39)	missense	probably benign	0.14
R5873:Evpl	UTSW	11	116,125,258 (GRCm39)	missense	probably damaging	1.00
R6298:Evpl	UTSW	11	116,121,748 (GRCm39)	missense	probably damaging	1.00
R6438:Evpl	UTSW	11	116,120,927 (GRCm39)	missense	probably benign	0.00
R6742:Evpl	UTSW	11	116,113,640 (GRCm39)	missense	possibly damaging	0.80
R6753:Evpl	UTSW	11	116,128,732 (GRCm39)	missense	possibly damaging	0.95
R6764:Evpl	UTSW	11	116,113,770 (GRCm39)	missense	probably damaging	0.99
R6846:Evpl	UTSW	11	116,114,633 (GRCm39)	missense	probably damaging	1.00
R7278:Evpl	UTSW	11	116,113,939 (GRCm39)	missense	probably damaging	1.00
R7288:Evpl	UTSW	11	116,114,775 (GRCm39)	missense	probably benign
R7395:Evpl	UTSW	11	116,117,905 (GRCm39)	missense	possibly damaging	0.94
R7441:Evpl	UTSW	11	116,113,782 (GRCm39)	nonsense	probably null
R7505:Evpl	UTSW	11	116,117,813 (GRCm39)	critical splice donor site	probably null
R7674:Evpl	UTSW	11	116,113,394 (GRCm39)	missense	probably benign	0.40
R7772:Evpl	UTSW	11	116,112,261 (GRCm39)	missense	probably benign	0.00
R7780:Evpl	UTSW	11	116,125,000 (GRCm39)	missense	not run
R7861:Evpl	UTSW	11	116,118,895 (GRCm39)	missense	probably damaging	1.00
R7928:Evpl	UTSW	11	116,113,359 (GRCm39)	missense	possibly damaging	0.63
R8008:Evpl	UTSW	11	116,121,298 (GRCm39)	missense	probably null	0.21
R8040:Evpl	UTSW	11	116,113,758 (GRCm39)	missense	probably damaging	0.99
R8052:Evpl	UTSW	11	116,113,989 (GRCm39)	missense	probably benign	0.00
R8402:Evpl	UTSW	11	116,116,197 (GRCm39)	missense	probably benign	0.03
R8513:Evpl	UTSW	11	116,120,570 (GRCm39)	critical splice donor site	probably null
R8695:Evpl	UTSW	11	116,114,489 (GRCm39)	missense	probably benign	0.02
R8725:Evpl	UTSW	11	116,113,019 (GRCm39)	missense	probably benign	0.25
R8749:Evpl	UTSW	11	116,120,232 (GRCm39)	missense	probably benign	0.01
R8807:Evpl	UTSW	11	116,111,853 (GRCm39)	missense	probably damaging	1.00
R8883:Evpl	UTSW	11	116,121,243 (GRCm39)	missense	probably damaging	0.99
R8947:Evpl	UTSW	11	116,112,164 (GRCm39)	missense	probably damaging	1.00
R9123:Evpl	UTSW	11	116,115,008 (GRCm39)	missense	possibly damaging	0.62
R9314:Evpl	UTSW	11	116,118,503 (GRCm39)	missense	probably benign	0.13
R9581:Evpl	UTSW	11	116,120,660 (GRCm39)	missense	probably benign	0.30
R9665:Evpl	UTSW	11	116,123,497 (GRCm39)	missense	probably damaging	1.00
R9688:Evpl	UTSW	11	116,124,986 (GRCm39)	missense	probably damaging	1.00
R9756:Evpl	UTSW	11	116,112,077 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTTTCTGGAGGAGGTCGACC -3'
(R):5'- AGTTACTGCTGCTGGAGAGGAG -3'

Sequencing Primer
(F):5'- GTCGACCTGAACCTGCAGAC -3'
(R):5'- TGGTCACCCAGAAGGACC -3'

Posted On

2020-08-01