Incidental Mutation 'R0051:Nlrp2'
ID 64288
Institutional Source Beutler Lab
Gene Symbol Nlrp2
Ensembl Gene ENSMUSG00000035177
Gene Name NLR family, pyrin domain containing 2
Synonyms Nbs1, Pan1, PYPAF2, E330007A02Rik, Nalp2
MMRRC Submission 038345-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0051 (G1)
Quality Score 118
Status Validated
Chromosome 7
Chromosomal Location 5298547-5351035 bp(-) (GRCm38)
Type of Mutation unclassified
DNA Base Change (assembly) A to T at 5322334 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146451 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045022] [ENSMUST00000207520] [ENSMUST00000207685]
AlphaFold Q4PLS0
Predicted Effect probably benign
Transcript: ENSMUST00000045022
SMART Domains Protein: ENSMUSP00000045077
Gene: ENSMUSG00000035177

DomainStartEndE-ValueType
PYRIN 7 90 2.88e-17 SMART
Pfam:NACHT 180 348 6.9e-30 PFAM
internal_repeat_1 676 722 1.74e-5 PROSPERO
LRR 796 823 1.26e1 SMART
LRR 825 852 1.18e1 SMART
LRR 853 880 5.81e-2 SMART
LRR 882 909 3.39e-3 SMART
LRR 910 937 5.06e-2 SMART
LRR 939 966 5.23e0 SMART
LRR 967 994 3.58e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207520
Predicted Effect probably benign
Transcript: ENSMUST00000207685
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 93.8%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the nucleotide-binding and leucine-rich repeat receptor (NLR) family, and is predicted to contain an N-terminal pyrin effector domain (PYD), a centrally-located nucleotide-binding and oligomerization domain (NACHT) and C-terminal leucine-rich repeats (LRR). Members of this gene family are thought to be important regulators of immune responses. This gene product interacts with components of the IkB kinase (IKK) complex, and can regulate both caspase-1 and NF-kB (nuclear factor kappa-light-chain-enhancer of activated B cells) activity. The pyrin domain is necessary and sufficient for suppression of NF-kB activity. An allelic variant (rs147585490) has been found that is incapable of blocking the transcriptional activity of NF-kB. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik A G 7: 29,579,101 noncoding transcript Het
Abr T A 11: 76,472,502 Q163L probably benign Het
AI314180 A G 4: 58,832,729 L877S probably damaging Het
Ankrd11 C A 8: 122,889,742 C2457F probably damaging Het
Anks3 G C 16: 4,947,749 T163S probably benign Het
Cacna1d G A 14: 30,111,095 P908S probably damaging Het
Ccdc146 C A 5: 21,316,904 R374L possibly damaging Het
Cdc45 G T 16: 18,794,774 A348E probably damaging Het
Cfap46 A G 7: 139,676,035 C300R probably damaging Het
Coq2 T C 5: 100,663,685 N146S probably benign Het
Dalrd3 T C 9: 108,572,215 V120A possibly damaging Het
Dcp2 T A 18: 44,405,374 probably benign Het
Ddx39 A G 8: 83,720,622 K137R possibly damaging Het
Diaph3 A G 14: 87,037,454 probably null Het
Dmbt1 G T 7: 131,119,496 R1668L possibly damaging Het
Dnah7a T G 1: 53,521,086 probably benign Het
Dpp7 A G 2: 25,356,095 Y49H possibly damaging Het
Drd5 A G 5: 38,320,614 S317G probably benign Het
Ecsit C T 9: 22,076,288 V152I probably benign Het
Emc1 T A 4: 139,375,163 M923K possibly damaging Het
Fam102a G A 2: 32,558,053 R58Q possibly damaging Het
Fcrl6 A T 1: 172,598,753 L159Q probably benign Het
Frrs1 T C 3: 116,885,297 probably benign Het
Hspd1 A G 1: 55,082,046 probably benign Het
Impg2 T A 16: 56,258,048 S458T probably damaging Het
Klf17 T C 4: 117,760,392 Y256C probably damaging Het
Lnx2 A G 5: 147,029,353 F319L probably damaging Het
Mafg G T 11: 120,629,604 R57S probably damaging Het
Med13l T A 5: 118,742,655 W1271R probably damaging Het
Mrgprb1 A G 7: 48,447,214 S24P probably benign Het
Mtrf1l T C 10: 5,813,384 E315G probably damaging Het
Naip1 T C 13: 100,411,001 E1239G probably damaging Het
Ncaph2 T C 15: 89,369,664 S320P probably damaging Het
Nek11 A G 9: 105,218,539 probably benign Het
Odf3 C A 7: 140,850,221 probably benign Het
Rbm26 A C 14: 105,152,540 V216G possibly damaging Het
Rnf115 A G 3: 96,785,022 D178G probably damaging Het
Rtel1 C T 2: 181,350,656 Q424* probably null Het
Rwdd4a A G 8: 47,537,365 probably benign Het
Ryr3 T C 2: 112,869,075 D890G probably damaging Het
Scarb1 C A 5: 125,281,100 probably null Het
Serpina10 A G 12: 103,626,897 probably benign Het
Slc12a5 T A 2: 164,986,663 W508R probably damaging Het
Slc43a2 T C 11: 75,562,850 C225R probably damaging Het
Slc6a9 T C 4: 117,864,859 F440L probably damaging Het
Stac3 G A 10: 127,508,148 R305H probably damaging Het
Stk32b A G 5: 37,459,596 probably benign Het
Syna A T 5: 134,559,543 L184H probably damaging Het
Tmprss7 T C 16: 45,673,939 N401S probably damaging Het
Yeats2 T A 16: 20,193,724 Y557* probably null Het
Zcchc11 T G 4: 108,527,004 S1089R probably damaging Het
Zfp352 T C 4: 90,224,285 S221P probably damaging Het
Zfp575 A G 7: 24,586,087 V43A probably benign Het
Zfp775 A G 6: 48,620,772 T527A probably benign Het
Other mutations in Nlrp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Nlrp2 APN 7 5337548 missense probably benign 0.00
IGL00545:Nlrp2 APN 7 5328252 missense possibly damaging 0.89
IGL01311:Nlrp2 APN 7 5319239 missense possibly damaging 0.92
IGL01345:Nlrp2 APN 7 5317492 missense probably benign 0.16
IGL01583:Nlrp2 APN 7 5337770 missense probably damaging 1.00
IGL01659:Nlrp2 APN 7 5328035 missense probably damaging 1.00
IGL02240:Nlrp2 APN 7 5327823 missense probably damaging 1.00
IGL02353:Nlrp2 APN 7 5337599 missense probably damaging 1.00
IGL02360:Nlrp2 APN 7 5337599 missense probably damaging 1.00
IGL02399:Nlrp2 APN 7 5328810 missense probably damaging 1.00
IGL02441:Nlrp2 APN 7 5335567 critical splice donor site probably null
IGL02588:Nlrp2 APN 7 5327552 nonsense probably null
IGL02803:Nlrp2 APN 7 5328318 missense probably damaging 1.00
IGL02968:Nlrp2 APN 7 5301025 missense possibly damaging 0.81
IGL03342:Nlrp2 APN 7 5317483 missense probably damaging 1.00
BB006:Nlrp2 UTSW 7 5327499 missense probably damaging 1.00
BB016:Nlrp2 UTSW 7 5327499 missense probably damaging 1.00
R0027:Nlrp2 UTSW 7 5322448 missense probably damaging 1.00
R0079:Nlrp2 UTSW 7 5327730 missense possibly damaging 0.81
R0130:Nlrp2 UTSW 7 5322418 missense possibly damaging 0.77
R0157:Nlrp2 UTSW 7 5308770 missense possibly damaging 0.88
R0201:Nlrp2 UTSW 7 5328329 missense probably benign 0.00
R0276:Nlrp2 UTSW 7 5328109 missense probably benign 0.00
R0288:Nlrp2 UTSW 7 5328545 missense probably benign 0.19
R0332:Nlrp2 UTSW 7 5317630 missense probably damaging 1.00
R0724:Nlrp2 UTSW 7 5319222 missense probably damaging 1.00
R1241:Nlrp2 UTSW 7 5328431 missense probably damaging 1.00
R1355:Nlrp2 UTSW 7 5327491 missense possibly damaging 0.81
R1392:Nlrp2 UTSW 7 5329015 splice site probably benign
R1470:Nlrp2 UTSW 7 5300951 missense probably benign 0.18
R1470:Nlrp2 UTSW 7 5300951 missense probably benign 0.18
R1563:Nlrp2 UTSW 7 5308725 missense probably damaging 1.00
R1866:Nlrp2 UTSW 7 5327716 nonsense probably null
R1942:Nlrp2 UTSW 7 5322448 missense probably damaging 1.00
R1959:Nlrp2 UTSW 7 5327738 missense probably damaging 1.00
R1960:Nlrp2 UTSW 7 5327738 missense probably damaging 1.00
R1961:Nlrp2 UTSW 7 5327738 missense probably damaging 1.00
R2072:Nlrp2 UTSW 7 5325006 missense probably damaging 1.00
R2161:Nlrp2 UTSW 7 5325042 missense probably damaging 1.00
R2190:Nlrp2 UTSW 7 5319238 missense possibly damaging 0.95
R2243:Nlrp2 UTSW 7 5335598 missense probably benign 0.03
R2277:Nlrp2 UTSW 7 5328129 missense probably benign
R2334:Nlrp2 UTSW 7 5337535 missense probably benign 0.39
R3030:Nlrp2 UTSW 7 5327748 missense probably damaging 1.00
R3404:Nlrp2 UTSW 7 5319287 missense probably benign 0.01
R3941:Nlrp2 UTSW 7 5327552 nonsense probably null
R4021:Nlrp2 UTSW 7 5325012 missense probably benign 0.40
R4518:Nlrp2 UTSW 7 5325056 missense possibly damaging 0.85
R4666:Nlrp2 UTSW 7 5319189 missense probably benign 0.18
R4767:Nlrp2 UTSW 7 5328024 missense probably damaging 1.00
R4827:Nlrp2 UTSW 7 5328951 missense possibly damaging 0.60
R4873:Nlrp2 UTSW 7 5298859 missense probably benign 0.09
R4875:Nlrp2 UTSW 7 5298859 missense probably benign 0.09
R5020:Nlrp2 UTSW 7 5328077 missense probably damaging 1.00
R5293:Nlrp2 UTSW 7 5327615 missense probably damaging 1.00
R5310:Nlrp2 UTSW 7 5325008 missense probably benign 0.00
R5336:Nlrp2 UTSW 7 5328119 missense probably benign
R5390:Nlrp2 UTSW 7 5300909 missense probably benign 0.00
R5864:Nlrp2 UTSW 7 5322381 missense probably damaging 1.00
R5913:Nlrp2 UTSW 7 5324903 splice site probably null
R6173:Nlrp2 UTSW 7 5337809 missense probably damaging 0.96
R6274:Nlrp2 UTSW 7 5317555 missense probably damaging 1.00
R6303:Nlrp2 UTSW 7 5337761 missense probably damaging 1.00
R6343:Nlrp2 UTSW 7 5300926 missense possibly damaging 0.82
R6704:Nlrp2 UTSW 7 5325041 nonsense probably null
R6814:Nlrp2 UTSW 7 5308710 missense probably benign 0.01
R6872:Nlrp2 UTSW 7 5308710 missense probably benign 0.01
R7023:Nlrp2 UTSW 7 5328229 nonsense probably null
R7028:Nlrp2 UTSW 7 5328572 missense possibly damaging 0.93
R7109:Nlrp2 UTSW 7 5328617 missense probably damaging 1.00
R7203:Nlrp2 UTSW 7 5317534 missense probably damaging 1.00
R7322:Nlrp2 UTSW 7 5308645 missense possibly damaging 0.94
R7339:Nlrp2 UTSW 7 5327628 missense possibly damaging 0.95
R7573:Nlrp2 UTSW 7 5317469 critical splice donor site probably null
R7657:Nlrp2 UTSW 7 5319168 missense probably benign 0.01
R7929:Nlrp2 UTSW 7 5327499 missense probably damaging 1.00
R7964:Nlrp2 UTSW 7 5328528 missense probably damaging 1.00
R8097:Nlrp2 UTSW 7 5327651 missense probably damaging 1.00
R8276:Nlrp2 UTSW 7 5317495 missense probably benign 0.40
R8785:Nlrp2 UTSW 7 5327549 missense probably damaging 0.99
R8798:Nlrp2 UTSW 7 5327888 missense possibly damaging 0.86
R8982:Nlrp2 UTSW 7 5324979 missense probably damaging 1.00
R9030:Nlrp2 UTSW 7 5322458 missense probably null 0.00
R9038:Nlrp2 UTSW 7 5327479 missense probably benign 0.14
R9149:Nlrp2 UTSW 7 5327573 missense probably benign 0.01
R9229:Nlrp2 UTSW 7 5301053 missense possibly damaging 0.81
R9584:Nlrp2 UTSW 7 5319216 missense probably damaging 1.00
X0027:Nlrp2 UTSW 7 5327642 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- tctctgtctctctctcAGCATAAGCAA -3'
(R):5'- TCCCCAGATGATGCCTACGAGAAA -3'

Sequencing Primer
(F):5'- aagagttaggggaaggattgaag -3'
(R):5'- TGCCTACGAGAAATTGTGCC -3'
Posted On 2013-08-06