Mutagenetix > Incidental Mutations

Incidental Mutation 'R0051:4930432E11Rik'

64290

Institutional Source

Beutler Lab

Gene Symbol

4930432E11Rik

Ensembl Gene

ENSMUSG00000046958

Gene Name

RIKEN cDNA 4930432E11 gene

Synonyms

MMRRC Submission

038345-MU

Accession Numbers

NCBI RefSeq: none; Ensembl: ENSMUST00000053635; MGI:3045259

Is this an essential gene?

Probably non essential (E-score: 0.060) question?

Stock #

R0051 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

29558579-29582169 bp(+) (GRCm38)

Type of Mutation

exon

DNA Base Change (assembly)

A to G at 29579101 bp

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s):

AlphaFold

no structure available at present

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000053635

SMART Domains

Protein: ENSMUSP00000049518
Gene: ENSMUSG00000046958

Domain	Start	End	E-Value	Type
Blast:WD40	43	79	3e-11	BLAST
WD40	131	172	1.97e2	SMART
WD40	175	214	2.24e-2	SMART
Blast:WD40	257	296	4e-15	BLAST
WD40	393	437	1.32e2	SMART
WD40	494	533	2.15e-4	SMART
low complexity region	598	617	N/A	INTRINSIC
low complexity region	1082	1094	N/A	INTRINSIC
low complexity region	1107	1148	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000063585

SMART Domains

Protein: ENSMUSP00000063695
Gene: ENSMUSG00000051976

Domain	Start	End	E-Value	Type
low complexity region	15	28	N/A	INTRINSIC
internal_repeat_1	35	67	3.29e-5	PROSPERO
internal_repeat_1	73	102	3.29e-5	PROSPERO
low complexity region	122	135	N/A	INTRINSIC
coiled coil region	161	182	N/A	INTRINSIC
low complexity region	216	233	N/A	INTRINSIC
low complexity region	239	249	N/A	INTRINSIC

Meta Mutation Damage Score

0.1505

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.1%
20x: 93.8%

Validation Efficiency

100% (64/64)

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abr	T	A	11: 76,472,502	Q163L	probably benign	Het
AI314180	A	G	4: 58,832,729	L877S	probably damaging	Het
Ankrd11	C	A	8: 122,889,742	C2457F	probably damaging	Het
Anks3	G	C	16: 4,947,749	T163S	probably benign	Het
Cacna1d	G	A	14: 30,111,095	P908S	probably damaging	Het
Ccdc146	C	A	5: 21,316,904	R374L	possibly damaging	Het
Cdc45	G	T	16: 18,794,774	A348E	probably damaging	Het
Cfap46	A	G	7: 139,676,035	C300R	probably damaging	Het
Coq2	T	C	5: 100,663,685	N146S	probably benign	Het
Dalrd3	T	C	9: 108,572,215	V120A	possibly damaging	Het
Dcp2	T	A	18: 44,405,374		probably benign	Het
Ddx39	A	G	8: 83,720,622	K137R	possibly damaging	Het
Diaph3	A	G	14: 87,037,454		probably null	Het
Dmbt1	G	T	7: 131,119,496	R1668L	possibly damaging	Het
Dnah7a	T	G	1: 53,521,086		probably benign	Het
Dpp7	A	G	2: 25,356,095	Y49H	possibly damaging	Het
Drd5	A	G	5: 38,320,614	S317G	probably benign	Het
Ecsit	C	T	9: 22,076,288	V152I	probably benign	Het
Emc1	T	A	4: 139,375,163	M923K	possibly damaging	Het
Fam102a	G	A	2: 32,558,053	R58Q	possibly damaging	Het
Fcrl6	A	T	1: 172,598,753	L159Q	probably benign	Het
Frrs1	T	C	3: 116,885,297		probably benign	Het
Hspd1	A	G	1: 55,082,046		probably benign	Het
Impg2	T	A	16: 56,258,048	S458T	probably damaging	Het
Klf17	T	C	4: 117,760,392	Y256C	probably damaging	Het
Lnx2	A	G	5: 147,029,353	F319L	probably damaging	Het
Mafg	G	T	11: 120,629,604	R57S	probably damaging	Het
Med13l	T	A	5: 118,742,655	W1271R	probably damaging	Het
Mrgprb1	A	G	7: 48,447,214	S24P	probably benign	Het
Mtrf1l	T	C	10: 5,813,384	E315G	probably damaging	Het
Naip1	T	C	13: 100,411,001	E1239G	probably damaging	Het
Ncaph2	T	C	15: 89,369,664	S320P	probably damaging	Het
Nek11	A	G	9: 105,218,539		probably benign	Het
Nlrp2	A	T	7: 5,322,334		probably benign	Het
Odf3	C	A	7: 140,850,221		probably benign	Het
Rbm26	A	C	14: 105,152,540	V216G	possibly damaging	Het
Rnf115	A	G	3: 96,785,022	D178G	probably damaging	Het
Rtel1	C	T	2: 181,350,656	Q424*	probably null	Het
Rwdd4a	A	G	8: 47,537,365		probably benign	Het
Ryr3	T	C	2: 112,869,075	D890G	probably damaging	Het
Scarb1	C	A	5: 125,281,100		probably null	Het
Serpina10	A	G	12: 103,626,897		probably benign	Het
Slc12a5	T	A	2: 164,986,663	W508R	probably damaging	Het
Slc43a2	T	C	11: 75,562,850	C225R	probably damaging	Het
Slc6a9	T	C	4: 117,864,859	F440L	probably damaging	Het
Stac3	G	A	10: 127,508,148	R305H	probably damaging	Het
Stk32b	A	G	5: 37,459,596		probably benign	Het
Syna	A	T	5: 134,559,543	L184H	probably damaging	Het
Tmprss7	T	C	16: 45,673,939	N401S	probably damaging	Het
Yeats2	T	A	16: 20,193,724	Y557*	probably null	Het
Zcchc11	T	G	4: 108,527,004	S1089R	probably damaging	Het
Zfp352	T	C	4: 90,224,285	S221P	probably damaging	Het
Zfp575	A	G	7: 24,586,087	V43A	probably benign	Het
Zfp775	A	G	6: 48,620,772	T527A	probably benign	Het

Other mutations in 4930432E11Rik

Allele	Source	Chr	Coord	Type	Predicted Effect
IGL01121:4930432E11Rik	APN	7	29574001	unclassified	noncoding transcript
IGL01955:4930432E11Rik	APN	7	29573995	unclassified	noncoding transcript
IGL01971:4930432E11Rik	APN	7	29574562	unclassified	noncoding transcript
IGL02132:4930432E11Rik	APN	7	29563279	unclassified	noncoding transcript
IGL02484:4930432E11Rik	APN	7	29563352	unclassified	noncoding transcript
P0016:4930432E11Rik	UTSW	7	29563112	unclassified	noncoding transcript
R0060:4930432E11Rik	UTSW	7	29574170	unclassified	noncoding transcript
R0094:4930432E11Rik	UTSW	7	29560811	exon	noncoding transcript
R0268:4930432E11Rik	UTSW	7	29574602	unclassified	noncoding transcript
R0423:4930432E11Rik	UTSW	7	29562400	exon	noncoding transcript
R0478:4930432E11Rik	UTSW	7	29562589	exon	noncoding transcript
R0646:4930432E11Rik	UTSW	7	29561285	exon	noncoding transcript
R1208:4930432E11Rik	UTSW	7	29561283	exon	noncoding transcript
R1778:4930432E11Rik	UTSW	7	29560706	exon	noncoding transcript
R1779:4930432E11Rik	UTSW	7	29579166	exon	noncoding transcript
R1918:4930432E11Rik	UTSW	7	29574089	unclassified	noncoding transcript
R2360:4930432E11Rik	UTSW	7	29574789	unclassified	noncoding transcript
R3736:4930432E11Rik	UTSW	7	29574571	unclassified	noncoding transcript
R3780:4930432E11Rik	UTSW	7	29560838	exon	noncoding transcript
R4427:4930432E11Rik	UTSW	7	29579253	exon	noncoding transcript
R4835:4930432E11Rik	UTSW	7	29574901	unclassified	noncoding transcript
R4929:4930432E11Rik	UTSW	7	29574042	unclassified	noncoding transcript
R5042:4930432E11Rik	UTSW	7	29574502	unclassified	noncoding transcript
R5129:4930432E11Rik	UTSW	7	29561361	exon	noncoding transcript
R5371:4930432E11Rik	UTSW	7	29562493	exon	noncoding transcript
R5381:4930432E11Rik	UTSW	7	29562968	unclassified	noncoding transcript
R5586:4930432E11Rik	UTSW	7	29577728	unclassified	noncoding transcript
R5874:4930432E11Rik	UTSW	7	29581185	exon	noncoding transcript

Predicted Primers

PCR Primer
(F):5'- GGAAAAGCCAGGTAAATTGTTCCAGC -3'
(R):5'- GTGAGTCCTCTTCACCAAAACTGACC -3'

Sequencing Primer
(F):5'- CAAATGTTGAGGACCCTGGC -3'
(R):5'- TTCGTGGGCACAGCTTC -3'

Posted On

2013-08-06