Incidental Mutation 'BB017:Usp20'
ID 642931
Institutional Source Beutler Lab
Gene Symbol Usp20
Ensembl Gene ENSMUSG00000026854
Gene Name ubiquitin specific peptidase 20
Synonyms 1700055M05Rik, Vdu2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # BB017
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 30982279-31023586 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 31010544 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 357 (S357P)
Ref Sequence ENSEMBL: ENSMUSP00000099913 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061544] [ENSMUST00000102849] [ENSMUST00000170476]
AlphaFold Q8C6M1
Predicted Effect probably benign
Transcript: ENSMUST00000061544
SMART Domains Protein: ENSMUSP00000060167
Gene: ENSMUSG00000026854

DomainStartEndE-ValueType
Pfam:zf-UBP 30 95 3.2e-18 PFAM
low complexity region 128 138 N/A INTRINSIC
Pfam:UCH 144 210 2e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102849
AA Change: S357P

PolyPhen 2 Score 0.209 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000099913
Gene: ENSMUSG00000026854
AA Change: S357P

DomainStartEndE-ValueType
Pfam:zf-UBP 30 95 4.3e-17 PFAM
low complexity region 128 138 N/A INTRINSIC
Pfam:UCH 144 684 5e-63 PFAM
Pfam:UCH_1 145 669 8.8e-24 PFAM
DUSP 704 787 5.97e-28 SMART
DUSP 812 897 4.74e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136588
SMART Domains Protein: ENSMUSP00000119197
Gene: ENSMUSG00000026854

DomainStartEndE-ValueType
Pfam:zf-UBP 10 60 6.4e-12 PFAM
low complexity region 93 103 N/A INTRINSIC
Pfam:UCH 109 142 4.6e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170476
AA Change: S357P

PolyPhen 2 Score 0.209 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000127388
Gene: ENSMUSG00000026854
AA Change: S357P

DomainStartEndE-ValueType
Pfam:zf-UBP 30 95 3.4e-17 PFAM
low complexity region 128 138 N/A INTRINSIC
Pfam:UCH 144 270 1.2e-26 PFAM
Pfam:UCH_1 145 669 6.1e-20 PFAM
Pfam:UCH 324 684 1.6e-31 PFAM
DUSP 704 787 5.97e-28 SMART
DUSP 812 897 4.74e-31 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitin specific processing protease that was first identified as a substrate of the VHL (von Hippel-Lindau disease) protein E3 ubiquitin ligase complex. In addition to being ubiquitinated by the VHL-E3 ligase complex, this enzyme deubiquitinates hypoxia-inducible factor (HIF)-1 alpha and thereby causes increased expression of HIF-1alpha targeted genes which play a role in angiogenesis, glucose metabolism, cell proliferation and metastasis. The enzyme encoded by this gene also regulates G-protein coupled receptor signaling by mediating the deubiquitination of beta-2 adrenergic receptor (ADRB2). This enzyme is a ubiquitously expressed thiolester hydrolase. Alternative splicing results in multiple transcript variants encoding the same protein. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430403G16Rik A T 5: 109,675,756 C609* probably null Het
Adam20 C T 8: 40,797,070 T739I probably benign Het
Adam23 G T 1: 63,585,427 V805F possibly damaging Het
Adamts17 A T 7: 66,849,799 R31S probably damaging Het
Ano4 T A 10: 89,327,276 Y27F possibly damaging Het
Bbs2 A G 8: 94,069,997 V675A probably damaging Het
Brca2 A G 5: 150,558,510 E2839G probably damaging Het
Capn5 C T 7: 98,123,878 V640I probably benign Het
Casp4 C T 9: 5,321,318 T23M probably damaging Het
Cerk C T 15: 86,144,719 E379K possibly damaging Het
Comp G A 8: 70,373,853 G26D probably damaging Het
Cpxm1 G A 2: 130,395,062 A220V possibly damaging Het
Cyp2c69 G T 19: 39,842,990 P460T possibly damaging Het
Ddx23 T C 15: 98,648,623 D555G probably damaging Het
E2f6 T A 12: 16,819,057 I127K probably damaging Het
Efr3a T A 15: 65,861,740 D716E probably benign Het
Esp16 T G 17: 39,539,977 S82R possibly damaging Het
Fasn A C 11: 120,809,235 S2199A probably benign Het
Fscb A G 12: 64,472,563 S710P unknown Het
Gas7 A G 11: 67,665,391 I185M probably damaging Het
Glg1 A T 8: 111,160,735 L1047I possibly damaging Het
Golga5 A G 12: 102,484,422 N445D probably benign Het
Grin2c A T 11: 115,256,237 H377Q probably benign Het
Hmgcs1 T C 13: 119,699,963 I97T possibly damaging Het
Ifi211 T C 1: 173,906,203 T131A possibly damaging Het
Ifngr1 A G 10: 19,609,183 K310R probably damaging Het
Il18rap T C 1: 40,548,643 V467A probably damaging Het
Itgad C A 7: 128,183,108 Q239K probably benign Het
Jrkl T C 9: 13,245,501 I52V possibly damaging Het
Kdm6b A T 11: 69,399,952 D1630E unknown Het
Krt75 C A 15: 101,564,883 *552L probably null Het
Mbd2 A G 18: 70,568,877 D154G probably damaging Het
Mutyh A T 4: 116,816,956 N235Y probably benign Het
Myo5b A G 18: 74,731,754 T1348A probably benign Het
Ndufs7 T C 10: 80,253,785 probably null Het
Nup205 T G 6: 35,194,576 M458R probably damaging Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr1061 T A 2: 86,413,216 T279S probably damaging Het
Olfr1416 T A 1: 92,479,848 M258L probably benign Het
Olfr1475 G A 19: 13,479,655 P181L probably damaging Het
Olfr350 G T 2: 36,850,273 V76F probably damaging Het
Olfr392 A C 11: 73,815,100 probably benign Het
Olfr521 A T 7: 99,767,596 T145S probably benign Het
Olfr888 A G 9: 38,108,968 N89S possibly damaging Het
Plcl2 T G 17: 50,606,803 I280S probably benign Het
Ppargc1a A T 5: 51,472,922 Y618N unknown Het
Rab43 A T 6: 87,811,366 I60N probably damaging Het
Rnf126 A T 10: 79,760,892 C231S probably damaging Het
Rnf220 T A 4: 117,307,590 E238D probably damaging Het
Scn9a A T 2: 66,504,849 D1265E probably damaging Het
Sntb2 T A 8: 107,001,637 S406T probably damaging Het
Sos1 T C 17: 80,406,838 I1068V probably benign Het
Spg20 A G 3: 55,128,276 K519E probably damaging Het
Tlx3 A T 11: 33,203,058 F134L probably damaging Het
Trbj1-2 A T 6: 41,534,030 T10S Het
Txk A C 5: 72,735,193 L33R probably damaging Het
Ulk2 A G 11: 61,791,432 probably null Het
Wac T A 18: 7,921,560 N565K possibly damaging Het
Zfp709 G T 8: 71,890,840 K704N probably damaging Het
Zfp788 C T 7: 41,649,625 Q562* probably null Het
Other mutations in Usp20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00973:Usp20 APN 2 31004950 missense probably damaging 1.00
IGL01444:Usp20 APN 2 30998789 start codon destroyed probably null 1.00
IGL01601:Usp20 APN 2 31011794 missense probably benign 0.04
IGL01785:Usp20 APN 2 31017163 missense probably benign 0.02
IGL01786:Usp20 APN 2 31017163 missense probably benign 0.02
IGL02129:Usp20 APN 2 31004450 missense probably benign 0.43
IGL02147:Usp20 APN 2 31006401 missense probably damaging 1.00
IGL03396:Usp20 APN 2 31011717 missense probably benign
BB007:Usp20 UTSW 2 31010544 missense probably benign 0.21
PIT4453001:Usp20 UTSW 2 31017486 missense possibly damaging 0.47
R0111:Usp20 UTSW 2 31002612 missense probably damaging 1.00
R0369:Usp20 UTSW 2 31011104 missense probably benign 0.00
R0479:Usp20 UTSW 2 31017475 missense probably benign 0.18
R0538:Usp20 UTSW 2 31004450 missense probably damaging 0.99
R1023:Usp20 UTSW 2 31007813 missense probably damaging 1.00
R1183:Usp20 UTSW 2 31011785 missense probably benign 0.17
R1635:Usp20 UTSW 2 31018818 missense probably benign 0.03
R2114:Usp20 UTSW 2 31016305 missense probably damaging 1.00
R2115:Usp20 UTSW 2 31016305 missense probably damaging 1.00
R2116:Usp20 UTSW 2 31016305 missense probably damaging 1.00
R2117:Usp20 UTSW 2 31016305 missense probably damaging 1.00
R2232:Usp20 UTSW 2 31018738 missense probably benign 0.13
R2244:Usp20 UTSW 2 31010331 missense possibly damaging 0.65
R2883:Usp20 UTSW 2 31018800 missense probably benign
R4734:Usp20 UTSW 2 31019824 missense probably benign 0.31
R5507:Usp20 UTSW 2 31010226 missense probably benign
R5770:Usp20 UTSW 2 31017508 missense probably damaging 1.00
R5862:Usp20 UTSW 2 31006449 nonsense probably null
R6315:Usp20 UTSW 2 31017758 missense possibly damaging 0.70
R7603:Usp20 UTSW 2 31011474 missense probably damaging 1.00
R7887:Usp20 UTSW 2 31020894 missense probably benign 0.34
R7930:Usp20 UTSW 2 31010544 missense probably benign 0.21
R8542:Usp20 UTSW 2 31011624 missense possibly damaging 0.94
R8965:Usp20 UTSW 2 31011785 missense possibly damaging 0.77
R9079:Usp20 UTSW 2 31005108 intron probably benign
R9226:Usp20 UTSW 2 31017400 missense probably damaging 0.99
R9417:Usp20 UTSW 2 30983018 critical splice acceptor site probably null
R9459:Usp20 UTSW 2 31011012 missense probably damaging 0.99
Z1176:Usp20 UTSW 2 31019818 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AGTTTCTGTCCTGTGACTCG -3'
(R):5'- CAACTGAGGCCCAAGACTAG -3'

Sequencing Primer
(F):5'- TCTGTCCTGTGACTCGAGCAG -3'
(R):5'- CAGCCTGTGAGGAAGGCTTG -3'
Posted On 2020-08-01