Incidental Mutation 'BB017:Txk'
ID642941
Institutional Source Beutler Lab
Gene Symbol Txk
Ensembl Gene ENSMUSG00000054892
Gene NameTXK tyrosine kinase
SynonymsA130089B16Rik, PTK4, Btkl, Rlk
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #BB017
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location72695978-72752777 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 72735193 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 33 (L33R)
Ref Sequence ENSEMBL: ENSMUSP00000109234 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113604] [ENSMUST00000169534] [ENSMUST00000197313] [ENSMUST00000198464]
Predicted Effect probably damaging
Transcript: ENSMUST00000113604
AA Change: L33R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109234
Gene: ENSMUSG00000054892
AA Change: L33R

DomainStartEndE-ValueType
low complexity region 8 28 N/A INTRINSIC
low complexity region 72 81 N/A INTRINSIC
SH3 85 141 9.99e-17 SMART
SH2 148 237 8.27e-34 SMART
TyrKc 271 520 2.52e-134 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000169534
AA Change: L33R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000129397
Gene: ENSMUSG00000054892
AA Change: L33R

DomainStartEndE-ValueType
low complexity region 8 28 N/A INTRINSIC
low complexity region 72 81 N/A INTRINSIC
SH3 85 141 9.99e-17 SMART
SH2 148 237 8.27e-34 SMART
TyrKc 271 520 2.52e-134 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000197313
AA Change: L33R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143476
Gene: ENSMUSG00000054892
AA Change: L33R

DomainStartEndE-ValueType
low complexity region 8 28 N/A INTRINSIC
low complexity region 72 81 N/A INTRINSIC
SH3 85 138 1.2e-9 SMART
SH2 126 215 3.1e-35 SMART
TyrKc 249 498 1.2e-136 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000198464
SMART Domains Protein: ENSMUSP00000143002
Gene: ENSMUSG00000054892

DomainStartEndE-ValueType
low complexity region 18 27 N/A INTRINSIC
SH3 31 87 6.3e-19 SMART
SH2 94 183 5.4e-36 SMART
TyrKc 217 466 1.2e-136 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in increased susceptibility to parasitic (Toxoplasma gondii) infection and decreased cytokine secretion in stimulated splenocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430403G16Rik A T 5: 109,675,756 C609* probably null Het
Adam20 C T 8: 40,797,070 T739I probably benign Het
Adam23 G T 1: 63,585,427 V805F possibly damaging Het
Adamts17 A T 7: 66,849,799 R31S probably damaging Het
Ano4 T A 10: 89,327,276 Y27F possibly damaging Het
Bbs2 A G 8: 94,069,997 V675A probably damaging Het
Brca2 A G 5: 150,558,510 E2839G probably damaging Het
Capn5 C T 7: 98,123,878 V640I probably benign Het
Casp4 C T 9: 5,321,318 T23M probably damaging Het
Cerk C T 15: 86,144,719 E379K possibly damaging Het
Comp G A 8: 70,373,853 G26D probably damaging Het
Cpxm1 G A 2: 130,395,062 A220V possibly damaging Het
Cyp2c69 G T 19: 39,842,990 P460T possibly damaging Het
Ddx23 T C 15: 98,648,623 D555G probably damaging Het
E2f6 T A 12: 16,819,057 I127K probably damaging Het
Efr3a T A 15: 65,861,740 D716E probably benign Het
Esp16 T G 17: 39,539,977 S82R possibly damaging Het
Fasn A C 11: 120,809,235 S2199A probably benign Het
Fscb A G 12: 64,472,563 S710P unknown Het
Gas7 A G 11: 67,665,391 I185M probably damaging Het
Glg1 A T 8: 111,160,735 L1047I possibly damaging Het
Golga5 A G 12: 102,484,422 N445D probably benign Het
Grin2c A T 11: 115,256,237 H377Q probably benign Het
Hmgcs1 T C 13: 119,699,963 I97T possibly damaging Het
Ifi211 T C 1: 173,906,203 T131A possibly damaging Het
Ifngr1 A G 10: 19,609,183 K310R probably damaging Het
Il18rap T C 1: 40,548,643 V467A probably damaging Het
Itgad C A 7: 128,183,108 Q239K probably benign Het
Jrkl T C 9: 13,245,501 I52V possibly damaging Het
Kdm6b A T 11: 69,399,952 D1630E unknown Het
Krt75 C A 15: 101,564,883 *552L probably null Het
Mbd2 A G 18: 70,568,877 D154G probably damaging Het
Mutyh A T 4: 116,816,956 N235Y probably benign Het
Myo5b A G 18: 74,731,754 T1348A probably benign Het
Ndufs7 T C 10: 80,253,785 probably null Het
Nup205 T G 6: 35,194,576 M458R probably damaging Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr1061 T A 2: 86,413,216 T279S probably damaging Het
Olfr1416 T A 1: 92,479,848 M258L probably benign Het
Olfr1475 G A 19: 13,479,655 P181L probably damaging Het
Olfr350 G T 2: 36,850,273 V76F probably damaging Het
Olfr392 A C 11: 73,815,100 probably benign Het
Olfr521 A T 7: 99,767,596 T145S probably benign Het
Olfr888 A G 9: 38,108,968 N89S possibly damaging Het
Plcl2 T G 17: 50,606,803 I280S probably benign Het
Ppargc1a A T 5: 51,472,922 Y618N unknown Het
Rab43 A T 6: 87,811,366 I60N probably damaging Het
Rnf126 A T 10: 79,760,892 C231S probably damaging Het
Rnf220 T A 4: 117,307,590 E238D probably damaging Het
Scn9a A T 2: 66,504,849 D1265E probably damaging Het
Sntb2 T A 8: 107,001,637 S406T probably damaging Het
Sos1 T C 17: 80,406,838 I1068V probably benign Het
Spg20 A G 3: 55,128,276 K519E probably damaging Het
Tlx3 A T 11: 33,203,058 F134L probably damaging Het
Trbj1-2 A T 6: 41,534,030 T10S Het
Ulk2 A G 11: 61,791,432 probably null Het
Usp20 T C 2: 31,010,544 S357P probably benign Het
Wac T A 18: 7,921,560 N565K possibly damaging Het
Zfp709 G T 8: 71,890,840 K704N probably damaging Het
Zfp788 C T 7: 41,649,625 Q562* probably null Het
Other mutations in Txk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02337:Txk APN 5 72707546 missense possibly damaging 0.94
IGL02602:Txk APN 5 72707720 missense possibly damaging 0.89
IGL03353:Txk APN 5 72736402 missense probably benign
BB007:Txk UTSW 5 72735193 missense probably damaging 1.00
R0402:Txk UTSW 5 72731762 critical splice donor site probably null
R1509:Txk UTSW 5 72699110 missense probably damaging 1.00
R1511:Txk UTSW 5 72707671 missense probably damaging 1.00
R1785:Txk UTSW 5 72696579 missense probably damaging 1.00
R1786:Txk UTSW 5 72696579 missense probably damaging 1.00
R2131:Txk UTSW 5 72696579 missense probably damaging 1.00
R2913:Txk UTSW 5 72724451 missense probably damaging 1.00
R2914:Txk UTSW 5 72724451 missense probably damaging 1.00
R3722:Txk UTSW 5 72707735 nonsense probably null
R4080:Txk UTSW 5 72700663 missense probably damaging 1.00
R5341:Txk UTSW 5 72696621 missense probably benign 0.08
R5580:Txk UTSW 5 72707589 missense probably damaging 1.00
R6155:Txk UTSW 5 72700726 missense probably damaging 1.00
R6310:Txk UTSW 5 72736417 missense probably benign 0.01
R6382:Txk UTSW 5 72736480 intron probably benign
R6938:Txk UTSW 5 72699149 missense probably damaging 0.99
R7225:Txk UTSW 5 72700714 missense probably damaging 1.00
R7327:Txk UTSW 5 72715883 missense probably damaging 0.98
R7337:Txk UTSW 5 72731766 nonsense probably null
R7436:Txk UTSW 5 72696579 missense probably damaging 1.00
R7510:Txk UTSW 5 72736383 missense unknown
R7709:Txk UTSW 5 72707575 missense probably damaging 1.00
R7725:Txk UTSW 5 72707557 missense probably damaging 0.96
R7930:Txk UTSW 5 72735193 missense probably damaging 1.00
R8124:Txk UTSW 5 72703263 splice site probably null
Z1176:Txk UTSW 5 72735211 missense unknown
Predicted Primers PCR Primer
(F):5'- TAGCTTAACTGGATTGCCCC -3'
(R):5'- CCAGCTCAGAATCTGTGGAAGG -3'

Sequencing Primer
(F):5'- ACCCATCATGATTCTAGTTTGGG -3'
(R):5'- CTCAGAATCTGTGGAAGGAGTTAG -3'
Posted On2020-08-01