Incidental Mutation 'BB017:Tlx3'
ID 642965
Institutional Source Beutler Lab
Gene Symbol Tlx3
Ensembl Gene ENSMUSG00000040610
Gene Name T cell leukemia, homeobox 3
Synonyms Hox11l2, Rnx, Tlx1l2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # BB017
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 33200752-33203589 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 33203058 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 134 (F134L)
Ref Sequence ENSEMBL: ENSMUSP00000047457 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037746]
AlphaFold O55144
Predicted Effect probably damaging
Transcript: ENSMUST00000037746
AA Change: F134L

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000047457
Gene: ENSMUSG00000040610
AA Change: F134L

DomainStartEndE-ValueType
low complexity region 45 53 N/A INTRINSIC
low complexity region 95 115 N/A INTRINSIC
HOX 166 228 1.37e-24 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an orphan homeobox protein that encodes a DNA-binding nuclear transcription factor. A translocation [t(5;14)(q35;q32)] involving this gene is associated with T-cell acute lymphoblastic leukemia (T-ALL) in children and young adults. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygous null mice die within 1 day of birth due to a central respiratory failure that resembles human congenital central hypoventilation syndrome. Mice homozygous for an ENU-induced allele exhibit uncoordinated movements. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430403G16Rik A T 5: 109,675,756 C609* probably null Het
Adam20 C T 8: 40,797,070 T739I probably benign Het
Adam23 G T 1: 63,585,427 V805F possibly damaging Het
Adamts17 A T 7: 66,849,799 R31S probably damaging Het
Ano4 T A 10: 89,327,276 Y27F possibly damaging Het
Bbs2 A G 8: 94,069,997 V675A probably damaging Het
Brca2 A G 5: 150,558,510 E2839G probably damaging Het
Capn5 C T 7: 98,123,878 V640I probably benign Het
Casp4 C T 9: 5,321,318 T23M probably damaging Het
Cerk C T 15: 86,144,719 E379K possibly damaging Het
Comp G A 8: 70,373,853 G26D probably damaging Het
Cpxm1 G A 2: 130,395,062 A220V possibly damaging Het
Cyp2c69 G T 19: 39,842,990 P460T possibly damaging Het
Ddx23 T C 15: 98,648,623 D555G probably damaging Het
E2f6 T A 12: 16,819,057 I127K probably damaging Het
Efr3a T A 15: 65,861,740 D716E probably benign Het
Esp16 T G 17: 39,539,977 S82R possibly damaging Het
Fasn A C 11: 120,809,235 S2199A probably benign Het
Fscb A G 12: 64,472,563 S710P unknown Het
Gas7 A G 11: 67,665,391 I185M probably damaging Het
Glg1 A T 8: 111,160,735 L1047I possibly damaging Het
Golga5 A G 12: 102,484,422 N445D probably benign Het
Grin2c A T 11: 115,256,237 H377Q probably benign Het
Hmgcs1 T C 13: 119,699,963 I97T possibly damaging Het
Ifi211 T C 1: 173,906,203 T131A possibly damaging Het
Ifngr1 A G 10: 19,609,183 K310R probably damaging Het
Il18rap T C 1: 40,548,643 V467A probably damaging Het
Itgad C A 7: 128,183,108 Q239K probably benign Het
Jrkl T C 9: 13,245,501 I52V possibly damaging Het
Kdm6b A T 11: 69,399,952 D1630E unknown Het
Krt75 C A 15: 101,564,883 *552L probably null Het
Mbd2 A G 18: 70,568,877 D154G probably damaging Het
Mutyh A T 4: 116,816,956 N235Y probably benign Het
Myo5b A G 18: 74,731,754 T1348A probably benign Het
Ndufs7 T C 10: 80,253,785 probably null Het
Nup205 T G 6: 35,194,576 M458R probably damaging Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr1061 T A 2: 86,413,216 T279S probably damaging Het
Olfr1416 T A 1: 92,479,848 M258L probably benign Het
Olfr1475 G A 19: 13,479,655 P181L probably damaging Het
Olfr350 G T 2: 36,850,273 V76F probably damaging Het
Olfr392 A C 11: 73,815,100 probably benign Het
Olfr521 A T 7: 99,767,596 T145S probably benign Het
Olfr888 A G 9: 38,108,968 N89S possibly damaging Het
Plcl2 T G 17: 50,606,803 I280S probably benign Het
Ppargc1a A T 5: 51,472,922 Y618N unknown Het
Rab43 A T 6: 87,811,366 I60N probably damaging Het
Rnf126 A T 10: 79,760,892 C231S probably damaging Het
Rnf220 T A 4: 117,307,590 E238D probably damaging Het
Scn9a A T 2: 66,504,849 D1265E probably damaging Het
Sntb2 T A 8: 107,001,637 S406T probably damaging Het
Sos1 T C 17: 80,406,838 I1068V probably benign Het
Spg20 A G 3: 55,128,276 K519E probably damaging Het
Trbj1-2 A T 6: 41,534,030 T10S Het
Txk A C 5: 72,735,193 L33R probably damaging Het
Ulk2 A G 11: 61,791,432 probably null Het
Usp20 T C 2: 31,010,544 S357P probably benign Het
Wac T A 18: 7,921,560 N565K possibly damaging Het
Zfp709 G T 8: 71,890,840 K704N probably damaging Het
Zfp788 C T 7: 41,649,625 Q562* probably null Het
Other mutations in Tlx3
AlleleSourceChrCoordTypePredicted EffectPPH Score
BB007:Tlx3 UTSW 11 33203058 missense probably damaging 0.99
R0866:Tlx3 UTSW 11 33203315 missense probably damaging 0.99
R1899:Tlx3 UTSW 11 33203072 missense probably benign 0.30
R6228:Tlx3 UTSW 11 33202432 missense probably benign 0.13
R6342:Tlx3 UTSW 11 33202567 missense possibly damaging 0.67
R7067:Tlx3 UTSW 11 33203204 missense probably damaging 1.00
R7290:Tlx3 UTSW 11 33203514 start gained probably benign
R7930:Tlx3 UTSW 11 33203058 missense probably damaging 0.99
R8055:Tlx3 UTSW 11 33201283 missense probably damaging 1.00
Z1176:Tlx3 UTSW 11 33203261 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- ACAGTGCTCCGCTATTTCG -3'
(R):5'- GTGTCAACCTAAGCTTGGCC -3'

Sequencing Primer
(F):5'- AGCTTCAAGCCAGGCAG -3'
(R):5'- CTAAGCTTGGCCCCCGC -3'
Posted On 2020-08-01