Mutagenetix > Incidental Mutation

Incidental Mutation 'R0051:Ankrd11'

64297

Institutional Source

Beutler Lab

Gene Symbol

Ankrd11

Ensembl Gene

ENSMUSG00000035569

Gene Name

ankyrin repeat domain 11

Synonyms

3010027A04Rik, Yod, 2410104C19Rik, 9530048I21Rik

MMRRC Submission

038345-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0051 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

122883822-123042277 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 122889742 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Phenylalanine at position 2457 (C2457F)

Ref Sequence

ENSEMBL: ENSMUSP00000095938 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000098333] [ENSMUST00000098334] [ENSMUST00000127664] [ENSMUST00000172906]

AlphaFold

E9Q4F7

Predicted Effect

probably damaging
Transcript: ENSMUST00000098333
AA Change: C2457F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000095938
Gene: ENSMUSG00000035569
AA Change: C2457F

Domain	Start	End	E-Value	Type
ANK	188	217	2.58e-3	SMART
ANK	221	250	1.31e-4	SMART
ANK	254	283	5.04e-6	SMART
low complexity region	311	324	N/A	INTRINSIC
low complexity region	366	377	N/A	INTRINSIC
low complexity region	429	440	N/A	INTRINSIC
low complexity region	470	487	N/A	INTRINSIC
low complexity region	499	521	N/A	INTRINSIC
low complexity region	534	549	N/A	INTRINSIC
low complexity region	596	609	N/A	INTRINSIC
low complexity region	649	669	N/A	INTRINSIC
coiled coil region	786	826	N/A	INTRINSIC
low complexity region	867	877	N/A	INTRINSIC
low complexity region	965	984	N/A	INTRINSIC
low complexity region	1040	1055	N/A	INTRINSIC
low complexity region	1058	1082	N/A	INTRINSIC
low complexity region	1187	1200	N/A	INTRINSIC
low complexity region	1204	1227	N/A	INTRINSIC
low complexity region	1268	1289	N/A	INTRINSIC
low complexity region	1294	1306	N/A	INTRINSIC
coiled coil region	1374	1406	N/A	INTRINSIC
low complexity region	1476	1496	N/A	INTRINSIC
low complexity region	1508	1523	N/A	INTRINSIC
low complexity region	1526	1547	N/A	INTRINSIC
coiled coil region	1598	1625	N/A	INTRINSIC
low complexity region	1770	1781	N/A	INTRINSIC
low complexity region	1874	1885	N/A	INTRINSIC
low complexity region	1913	1922	N/A	INTRINSIC
low complexity region	1969	1979	N/A	INTRINSIC
low complexity region	2035	2045	N/A	INTRINSIC
low complexity region	2057	2071	N/A	INTRINSIC
low complexity region	2162	2179	N/A	INTRINSIC
low complexity region	2191	2209	N/A	INTRINSIC
low complexity region	2224	2236	N/A	INTRINSIC
low complexity region	2250	2263	N/A	INTRINSIC
low complexity region	2294	2305	N/A	INTRINSIC
low complexity region	2391	2409	N/A	INTRINSIC
low complexity region	2445	2455	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000098334
AA Change: C2436F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000095939
Gene: ENSMUSG00000035569
AA Change: C2436F

Domain	Start	End	E-Value	Type
ANK	167	196	2.58e-3	SMART
ANK	200	229	1.31e-4	SMART
ANK	233	262	5.04e-6	SMART
low complexity region	290	303	N/A	INTRINSIC
low complexity region	345	356	N/A	INTRINSIC
low complexity region	408	419	N/A	INTRINSIC
low complexity region	449	466	N/A	INTRINSIC
low complexity region	478	500	N/A	INTRINSIC
low complexity region	513	528	N/A	INTRINSIC
low complexity region	575	588	N/A	INTRINSIC
low complexity region	628	648	N/A	INTRINSIC
coiled coil region	765	805	N/A	INTRINSIC
low complexity region	846	856	N/A	INTRINSIC
low complexity region	944	963	N/A	INTRINSIC
low complexity region	1019	1034	N/A	INTRINSIC
low complexity region	1037	1061	N/A	INTRINSIC
low complexity region	1166	1179	N/A	INTRINSIC
low complexity region	1183	1206	N/A	INTRINSIC
low complexity region	1247	1268	N/A	INTRINSIC
low complexity region	1273	1285	N/A	INTRINSIC
coiled coil region	1353	1385	N/A	INTRINSIC
low complexity region	1455	1475	N/A	INTRINSIC
low complexity region	1487	1502	N/A	INTRINSIC
low complexity region	1505	1526	N/A	INTRINSIC
coiled coil region	1577	1604	N/A	INTRINSIC
low complexity region	1749	1760	N/A	INTRINSIC
low complexity region	1853	1864	N/A	INTRINSIC
low complexity region	1892	1901	N/A	INTRINSIC
low complexity region	1948	1958	N/A	INTRINSIC
low complexity region	2014	2024	N/A	INTRINSIC
low complexity region	2036	2050	N/A	INTRINSIC
low complexity region	2141	2158	N/A	INTRINSIC
low complexity region	2170	2188	N/A	INTRINSIC
low complexity region	2203	2215	N/A	INTRINSIC
low complexity region	2229	2242	N/A	INTRINSIC
low complexity region	2273	2284	N/A	INTRINSIC
low complexity region	2370	2388	N/A	INTRINSIC
low complexity region	2424	2434	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000127664

SMART Domains

Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

Domain	Start	End	E-Value	Type
Pfam:Glycos_transf_2	104	287	7.4e-31	PFAM
Pfam:Glyco_transf_7C	261	331	4.9e-8	PFAM
RICIN	406	531	9.28e-27	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000172906

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211940

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212728

Meta Mutation Damage Score

0.9042

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.1%
20x: 93.8%

Validation Efficiency

100% (64/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes an ankryin repeat domain-containing protein. The encoded protein inhibits ligand-dependent activation of transcription. Mutations in this gene have been associated with KBG syndrome, which is characterized by macrodontia, distinctive craniofacial features, short stature, skeletal anomalies, global developmental delay, seizures and intellectual disability. Alternatively spliced transcript variants have been described. Related pseudogenes exist on chromosomes 2 and X. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a spontaneous allele die by E9.5, are small and fail to turn. Mice heterozygous for a spontaneous allele exhibit craniofacial abnormalities, decreased weight, osteoporosis and osteopenia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930432E11Rik	A	G	7: 29,579,101		noncoding transcript	Het
Abr	T	A	11: 76,472,502	Q163L	probably benign	Het
AI314180	A	G	4: 58,832,729	L877S	probably damaging	Het
Anks3	G	C	16: 4,947,749	T163S	probably benign	Het
Cacna1d	G	A	14: 30,111,095	P908S	probably damaging	Het
Ccdc146	C	A	5: 21,316,904	R374L	possibly damaging	Het
Cdc45	G	T	16: 18,794,774	A348E	probably damaging	Het
Cfap46	A	G	7: 139,676,035	C300R	probably damaging	Het
Coq2	T	C	5: 100,663,685	N146S	probably benign	Het
Dalrd3	T	C	9: 108,572,215	V120A	possibly damaging	Het
Dcp2	T	A	18: 44,405,374		probably benign	Het
Ddx39	A	G	8: 83,720,622	K137R	possibly damaging	Het
Diaph3	A	G	14: 87,037,454		probably null	Het
Dmbt1	G	T	7: 131,119,496	R1668L	possibly damaging	Het
Dnah7a	T	G	1: 53,521,086		probably benign	Het
Dpp7	A	G	2: 25,356,095	Y49H	possibly damaging	Het
Drd5	A	G	5: 38,320,614	S317G	probably benign	Het
Ecsit	C	T	9: 22,076,288	V152I	probably benign	Het
Emc1	T	A	4: 139,375,163	M923K	possibly damaging	Het
Fam102a	G	A	2: 32,558,053	R58Q	possibly damaging	Het
Fcrl6	A	T	1: 172,598,753	L159Q	probably benign	Het
Frrs1	T	C	3: 116,885,297		probably benign	Het
Hspd1	A	G	1: 55,082,046		probably benign	Het
Impg2	T	A	16: 56,258,048	S458T	probably damaging	Het
Klf17	T	C	4: 117,760,392	Y256C	probably damaging	Het
Lnx2	A	G	5: 147,029,353	F319L	probably damaging	Het
Mafg	G	T	11: 120,629,604	R57S	probably damaging	Het
Med13l	T	A	5: 118,742,655	W1271R	probably damaging	Het
Mrgprb1	A	G	7: 48,447,214	S24P	probably benign	Het
Mtrf1l	T	C	10: 5,813,384	E315G	probably damaging	Het
Naip1	T	C	13: 100,411,001	E1239G	probably damaging	Het
Ncaph2	T	C	15: 89,369,664	S320P	probably damaging	Het
Nek11	A	G	9: 105,218,539		probably benign	Het
Nlrp2	A	T	7: 5,322,334		probably benign	Het
Odf3	C	A	7: 140,850,221		probably benign	Het
Rbm26	A	C	14: 105,152,540	V216G	possibly damaging	Het
Rnf115	A	G	3: 96,785,022	D178G	probably damaging	Het
Rtel1	C	T	2: 181,350,656	Q424*	probably null	Het
Rwdd4a	A	G	8: 47,537,365		probably benign	Het
Ryr3	T	C	2: 112,869,075	D890G	probably damaging	Het
Scarb1	C	A	5: 125,281,100		probably null	Het
Serpina10	A	G	12: 103,626,897		probably benign	Het
Slc12a5	T	A	2: 164,986,663	W508R	probably damaging	Het
Slc43a2	T	C	11: 75,562,850	C225R	probably damaging	Het
Slc6a9	T	C	4: 117,864,859	F440L	probably damaging	Het
Stac3	G	A	10: 127,508,148	R305H	probably damaging	Het
Stk32b	A	G	5: 37,459,596		probably benign	Het
Syna	A	T	5: 134,559,543	L184H	probably damaging	Het
Tmprss7	T	C	16: 45,673,939	N401S	probably damaging	Het
Yeats2	T	A	16: 20,193,724	Y557*	probably null	Het
Zcchc11	T	G	4: 108,527,004	S1089R	probably damaging	Het
Zfp352	T	C	4: 90,224,285	S221P	probably damaging	Het
Zfp575	A	G	7: 24,586,087	V43A	probably benign	Het
Zfp775	A	G	6: 48,620,772	T527A	probably benign	Het

Other mutations in Ankrd11

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00949:Ankrd11	APN	8	122908728	missense	possibly damaging	0.59
IGL00971:Ankrd11	APN	8	122895353	missense	probably damaging	1.00
IGL01017:Ankrd11	APN	8	122894728	missense	probably damaging	1.00
IGL01137:Ankrd11	APN	8	122884336	missense	probably damaging	0.99
IGL01659:Ankrd11	APN	8	122895371	missense	probably damaging	1.00
IGL01920:Ankrd11	APN	8	122915897	splice site	probably benign
IGL01964:Ankrd11	APN	8	122889736	missense	probably damaging	0.97
IGL02131:Ankrd11	APN	8	122894410	missense	probably damaging	1.00
IGL02226:Ankrd11	APN	8	122892245	missense	probably damaging	1.00
IGL02549:Ankrd11	APN	8	122891293	missense	probably damaging	1.00
IGL02642:Ankrd11	APN	8	122890651	missense	probably damaging	1.00
IGL02643:Ankrd11	APN	8	122892322	missense	probably damaging	0.98
IGL02861:Ankrd11	APN	8	122895827	missense	probably damaging	0.99
IGL03086:Ankrd11	APN	8	122894510	missense	probably damaging	1.00
IGL03336:Ankrd11	APN	8	122891843	missense	probably benign	0.00
anchors	UTSW	8	122895770	missense	probably damaging	0.99
away	UTSW	8	122891953	missense	probably damaging	1.00
bluebell	UTSW	8	122891785	missense	probably damaging	0.97
Navy	UTSW	8	122908734	nonsense	probably null
BB001:Ankrd11	UTSW	8	122895902	missense	possibly damaging	0.95
BB011:Ankrd11	UTSW	8	122895902	missense	possibly damaging	0.95
R0051:Ankrd11	UTSW	8	122889742	missense	probably damaging	1.00
R0110:Ankrd11	UTSW	8	122892175	missense	possibly damaging	0.95
R0281:Ankrd11	UTSW	8	122895568	missense	probably benign	0.01
R0450:Ankrd11	UTSW	8	122892175	missense	possibly damaging	0.95
R0481:Ankrd11	UTSW	8	122900036	missense	probably damaging	1.00
R0542:Ankrd11	UTSW	8	122895770	missense	probably damaging	0.99
R0606:Ankrd11	UTSW	8	122892832	missense	probably benign	0.04
R0702:Ankrd11	UTSW	8	122889766	missense	probably damaging	1.00
R0730:Ankrd11	UTSW	8	122891953	missense	probably damaging	1.00
R0737:Ankrd11	UTSW	8	122895836	missense	probably damaging	0.99
R1401:Ankrd11	UTSW	8	122893050	missense	probably benign	0.23
R1464:Ankrd11	UTSW	8	122892724	missense	probably damaging	1.00
R1464:Ankrd11	UTSW	8	122892724	missense	probably damaging	1.00
R1470:Ankrd11	UTSW	8	122899724	missense	probably damaging	0.98
R1470:Ankrd11	UTSW	8	122899724	missense	probably damaging	0.98
R1641:Ankrd11	UTSW	8	122891746	missense	probably benign	0.03
R1950:Ankrd11	UTSW	8	122889869	missense	probably damaging	1.00
R2004:Ankrd11	UTSW	8	122902422	critical splice donor site	probably null
R2401:Ankrd11	UTSW	8	122908734	nonsense	probably null
R2425:Ankrd11	UTSW	8	122893163	missense	possibly damaging	0.86
R2830:Ankrd11	UTSW	8	122892196	missense	probably damaging	1.00
R2910:Ankrd11	UTSW	8	122908798	missense	probably damaging	1.00
R2911:Ankrd11	UTSW	8	122908798	missense	probably damaging	1.00
R3736:Ankrd11	UTSW	8	122891785	missense	probably damaging	0.97
R3738:Ankrd11	UTSW	8	122896715	unclassified	probably benign
R3739:Ankrd11	UTSW	8	122896715	unclassified	probably benign
R3813:Ankrd11	UTSW	8	122891378	missense	probably benign
R4012:Ankrd11	UTSW	8	122892417	missense	probably damaging	0.98
R4183:Ankrd11	UTSW	8	122899676	missense	possibly damaging	0.88
R4213:Ankrd11	UTSW	8	122891026	missense	probably benign	0.00
R4469:Ankrd11	UTSW	8	122896587	missense	probably damaging	1.00
R4482:Ankrd11	UTSW	8	122893489	missense	probably damaging	1.00
R4935:Ankrd11	UTSW	8	122900183	missense	probably benign	0.02
R4940:Ankrd11	UTSW	8	122889821	missense	probably damaging	1.00
R5145:Ankrd11	UTSW	8	122891204	utr 3 prime	probably benign
R5154:Ankrd11	UTSW	8	122893139	missense	probably damaging	1.00
R5230:Ankrd11	UTSW	8	122890477	missense	probably benign	0.11
R5283:Ankrd11	UTSW	8	122884182	missense	probably damaging	1.00
R5377:Ankrd11	UTSW	8	122893714	splice site	probably null
R5513:Ankrd11	UTSW	8	122892520	missense	probably benign	0.38
R5518:Ankrd11	UTSW	8	122890994	missense	possibly damaging	0.93
R5549:Ankrd11	UTSW	8	122890378	missense	probably benign	0.02
R5579:Ankrd11	UTSW	8	122884231	missense	probably damaging	0.97
R5595:Ankrd11	UTSW	8	122894304	nonsense	probably null
R5650:Ankrd11	UTSW	8	122887397	missense	probably damaging	0.99
R5717:Ankrd11	UTSW	8	122892638	missense	possibly damaging	0.92
R5753:Ankrd11	UTSW	8	122895304	missense	possibly damaging	0.90
R5782:Ankrd11	UTSW	8	122900017	missense	probably damaging	1.00
R5812:Ankrd11	UTSW	8	122893805	splice site	probably null
R5823:Ankrd11	UTSW	8	122895790	missense	probably benign	0.12
R5900:Ankrd11	UTSW	8	122891066	missense	probably benign	0.00
R5975:Ankrd11	UTSW	8	122889749	missense	possibly damaging	0.93
R5979:Ankrd11	UTSW	8	122892400	missense	probably damaging	1.00
R6000:Ankrd11	UTSW	8	122891195	missense	possibly damaging	0.73
R6145:Ankrd11	UTSW	8	122892661	missense	probably damaging	1.00
R6252:Ankrd11	UTSW	8	122893822	missense	possibly damaging	0.87
R6302:Ankrd11	UTSW	8	122889989	missense	probably benign
R6457:Ankrd11	UTSW	8	122908764	missense	probably damaging	1.00
R6513:Ankrd11	UTSW	8	122890180	missense	probably benign	0.02
R6582:Ankrd11	UTSW	8	122891629	missense	probably benign	0.00
R6738:Ankrd11	UTSW	8	122891921	missense	probably damaging	0.99
R6865:Ankrd11	UTSW	8	122894944	missense	probably benign	0.41
R6913:Ankrd11	UTSW	8	122894911	missense	probably benign	0.01
R7101:Ankrd11	UTSW	8	122895455	missense	probably benign	0.35
R7116:Ankrd11	UTSW	8	122896130	missense	probably damaging	1.00
R7477:Ankrd11	UTSW	8	122894385	missense	possibly damaging	0.91
R7534:Ankrd11	UTSW	8	122894410	missense	probably damaging	1.00
R7555:Ankrd11	UTSW	8	122887406	missense	probably damaging	0.99
R7627:Ankrd11	UTSW	8	122890951	missense	possibly damaging	0.63
R7658:Ankrd11	UTSW	8	122893664	missense	probably benign
R7721:Ankrd11	UTSW	8	122894759	missense	probably damaging	1.00
R7731:Ankrd11	UTSW	8	122895433	missense	probably benign	0.12
R7792:Ankrd11	UTSW	8	122884231	missense	probably damaging	0.97
R7924:Ankrd11	UTSW	8	122895902	missense	possibly damaging	0.95
R7939:Ankrd11	UTSW	8	122891073	missense	probably damaging	1.00
R8022:Ankrd11	UTSW	8	122887593	missense	probably damaging	1.00
R8222:Ankrd11	UTSW	8	122895608	missense	probably damaging	0.98
R8362:Ankrd11	UTSW	8	122892058	missense	probably damaging	0.96
R8430:Ankrd11	UTSW	8	122893366	missense	probably benign	0.01
R8511:Ankrd11	UTSW	8	122899729	missense
R8726:Ankrd11	UTSW	8	122894026	missense	possibly damaging	0.90
R8888:Ankrd11	UTSW	8	122894275	missense	possibly damaging	0.87
R8895:Ankrd11	UTSW	8	122894275	missense	possibly damaging	0.87
R8928:Ankrd11	UTSW	8	122895979	missense	probably damaging	0.99
R8930:Ankrd11	UTSW	8	122895979	missense	probably damaging	0.99
R8931:Ankrd11	UTSW	8	122895979	missense	probably damaging	0.99
R8936:Ankrd11	UTSW	8	122895101	missense	possibly damaging	0.69
R9018:Ankrd11	UTSW	8	122895512	missense	probably damaging	1.00
R9113:Ankrd11	UTSW	8	122887333	missense	possibly damaging	0.60
R9399:Ankrd11	UTSW	8	122891440	missense	probably benign
R9644:Ankrd11	UTSW	8	122890943	missense	probably benign	0.00
R9645:Ankrd11	UTSW	8	122890943	missense	probably benign	0.00
R9647:Ankrd11	UTSW	8	122890943	missense	probably benign	0.00
R9683:Ankrd11	UTSW	8	122890943	missense	probably benign	0.00
RF019:Ankrd11	UTSW	8	122896634	missense	probably damaging	1.00
Z1176:Ankrd11	UTSW	8	122895803	missense	possibly damaging	0.68
Z1177:Ankrd11	UTSW	8	122900142	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAAGAATGTCACTGCCTCCTGACC -3'
(R):5'- GGAAGAAGTTCCTCAGCGTATGACC -3'

Sequencing Primer
(F):5'- GCCTCCTGACCACACTG -3'
(R):5'- TATGACCAGGAACCGTGCC -3'

Posted On

2013-08-06